Morpholino

MO1-lgi1b

ID
ZDB-MRPHLNO-111206-1
Name
MO1-lgi1b
Previous Names
  • MO-E2 (1)
Target
Sequence
5' - AACACTAAGGGAAACTCACAGAAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO targeted to the splice donor region of the intron between Exon 2 and Exon 3.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lgi1b
Expressed Gene Anatomy Figures
fosab Fig. 6 with image from Teng et al., 2011
lgi1a Fig. 2 with image from Teng et al., 2011
lgi1b Fig. 2 with image from Teng et al., 2011
lgi2a Fig. 2 with image from Teng et al., 2011
lgi2b Fig. 2 with image from Teng et al., 2011
lgi3 Fig. 2 with image from Teng et al., 2011
Phenotype
Phenotype resulting from MO1-lgi1b
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO1-lgi1b Fig. 4 with image from Teng et al., 2011
brain decreased size, abnormal WT + MO1-lgi1b Fig. 4 with image from Teng et al., 2011
brain morphogenesis decreased process quality, abnormal WT + MO1-lgi1b Fig. 4 with image from Teng et al., 2011
eye decreased size, abnormal WT + MO1-lgi1b Fig. 3 with image from Teng et al., 2011
forebrain apoptotic, abnormal WT + MO1-lgi1b Fig. 4 with image from Teng et al., 2011
fourth ventricle hydrocephalic, abnormal WT + MO1-lgi1b Fig. 3 with image,  Fig. 7 with image from Teng et al., 2011
tectal ventricle hydrocephalic, abnormal WT + MO1-lgi1b Fig. 3 with image from Teng et al., 2011
Phenotype of all Fish created by or utilizing MO1-lgi1b
Phenotype Fish Conditions Figures
brain apoptotic, abnormal WT + MO1-lgi1b standard conditions Fig. 4 with image from Teng et al., 2011
tectal ventricle hydrocephalic, abnormal WT + MO1-lgi1b standard conditions Fig. 3 with image from Teng et al., 2011
fourth ventricle hydrocephalic, abnormal WT + MO1-lgi1b standard conditions Fig. 3 with image,  Fig. 7 with image from Teng et al., 2011
forebrain apoptotic, abnormal WT + MO1-lgi1b standard conditions Fig. 4 with image from Teng et al., 2011
brain morphogenesis decreased process quality, abnormal WT + MO1-lgi1b standard conditions Fig. 4 with image from Teng et al., 2011
eye decreased size, abnormal WT + MO1-lgi1b standard conditions Fig. 3 with image from Teng et al., 2011
brain decreased size, abnormal WT + MO1-lgi1b standard conditions Fig. 4 with image from Teng et al., 2011
post-vent region curved ventral, abnormal WT + MO1-lgi1b + MO2-lgi1a standard conditions Fig. 7 with image from Teng et al., 2011
fourth ventricle hydrocephalic, abnormal WT + MO1-lgi1b + MO2-lgi1a standard conditions Fig. 7 with image from Teng et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.