Morpholino

MO1-prmt5

ID

ZDB-MRPHLNO-111103-3

Name

MO1-prmt5

Previous Names

None

Target

prmt5 (1)

Sequence

5' - GACGCCATCGTTAGGAGACGAGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-prmt5

Expressed Gene	Anatomy	Figures
mef2ca	somite	Fig. 3 from Batut et al., 2011
myf5	somite	Fig. 3 from Batut et al., 2011
myod1	somite	Fig. 3 from Batut et al., 2011
myog	somite	Fig. 3 from Batut et al., 2011
prmt5	whole organism	Fig. 2 from Batut et al., 2011

Phenotype

Phenotype resulting from MO1-prmt5

Phenotype	Fish	Figures
dorsal aorta decreased size, abnormal	s940Tg/s940Tg + MO1-prmt5	Fig. 3 from Quillien et al., 2021
dorsal aorta Venus expression spatial pattern, abnormal	s940Tg/s940Tg + MO1-prmt5	Fig. 3 from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression decreased amount, abnormal	mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5	Fig. 5 from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression spatial pattern, abnormal	y1Tg/y1Tg + MO1-prmt5	Fig. 3 from Quillien et al., 2021
intersegmental vessel morphogenesis of a branching structure decreased process quality, abnormal	y1Tg/y1Tg + MO1-prmt5	Fig. 3 from Quillien et al., 2021
intersegmental vessel transcription cis-regulatory region binding decreased process quality, abnormal	mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5	Fig. 5 from Quillien et al., 2021
regulation of cell cycle disrupted, abnormal	WT + MO1-prmt5	Fig. 6 from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal	WT + MO1-prmt5	Fig. 6 from Batut et al., 2011
slow muscle cell decreased amount, abnormal	WT + MO1-prmt5	Fig. 4 from Batut et al., 2011
somite elongated, abnormal	WT + MO1-prmt5	Fig. 2 from Batut et al., 2011
somite flattened, abnormal	WT + MO1-prmt5	Fig. 2 from Batut et al., 2011
somite lacks parts or has fewer parts of type fast muscle cell, abnormal	WT + MO1-prmt5	Fig. 4 from Batut et al., 2011
thymus EGFP expression decreased amount, abnormal	mu271Tg/mu271Tg; sd32Tg/sd32Tg + MO1-prmt5	Fig 1 , Fig 2 from Quillien et al., 2021
trunk ab1-prmt5 labeling decreased amount, abnormal	WT + MO1-prmt5	Fig 2 from Quillien et al., 2021
whole organism Ab2-sDMA labeling decreased amount, abnormal	WT + MO1-prmt5	Fig 2 from Quillien et al., 2021
whole organism Ab1-wdr77 labeling decreased amount, abnormal	WT + MO1-prmt5	Fig 2 from Quillien et al., 2021
whole organism ab1-prmt5 labeling decreased amount, abnormal	WT + MO1-prmt5	Fig 2 from Quillien et al., 2021
whole organism decreased length, abnormal	WT + MO1-prmt5	Fig. 2 from Batut et al., 2011

Phenotype of all Fish created by or utilizing MO1-prmt5

Phenotype	Fish	Conditions	Figures
dorsal aorta decreased size, abnormal	s940Tg/s940Tg + MO1-prmt5	standard conditions	Fig. 3 from Quillien et al., 2021
dorsal aorta Venus expression spatial pattern, abnormal	s940Tg/s940Tg + MO1-prmt5	standard conditions	Fig. 3 from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression spatial pattern, abnormal	y1Tg/y1Tg + MO1-prmt5	standard conditions	Fig. 3 from Quillien et al., 2021
intersegmental vessel morphogenesis of a branching structure decreased process quality, abnormal	y1Tg/y1Tg + MO1-prmt5	standard conditions	Fig. 3 from Quillien et al., 2021
somite elongated, abnormal	WT + MO1-prmt5	standard conditions	Fig. 2 from Batut et al., 2011
whole organism decreased length, abnormal	WT + MO1-prmt5	standard conditions	Fig. 2 from Batut et al., 2011
whole organism ab1-prmt5 labeling decreased amount, abnormal	WT + MO1-prmt5	standard conditions	Fig 2 from Quillien et al., 2021
somite lacks parts or has fewer parts of type fast muscle cell, abnormal	WT + MO1-prmt5	standard conditions	Fig. 4 from Batut et al., 2011
regulation of cell cycle disrupted, abnormal	WT + MO1-prmt5	standard conditions	Fig. 6 from Batut et al., 2011
trunk ab1-prmt5 labeling decreased amount, abnormal	WT + MO1-prmt5	standard conditions	Fig 2 from Quillien et al., 2021
somite flattened, abnormal	WT + MO1-prmt5	standard conditions	Fig. 2 from Batut et al., 2011
whole organism Ab1-wdr77 labeling decreased amount, abnormal	WT + MO1-prmt5	standard conditions	Fig 2 from Quillien et al., 2021
slow muscle cell decreased amount, abnormal	WT + MO1-prmt5	standard conditions	Fig. 4 from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal	WT + MO1-prmt5	standard conditions	Fig. 6 from Batut et al., 2011
whole organism Ab2-sDMA labeling decreased amount, abnormal	WT + MO1-prmt5	standard conditions	Fig 2 from Quillien et al., 2021
dorsal aorta intersegmental vessel GFP expression decreased amount, abnormal	mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5	standard conditions	Fig. 5 from Quillien et al., 2021
intersegmental vessel transcription cis-regulatory region binding decreased process quality, abnormal	mu101Tg/mu101Tg; nkuasgfp1aTg/nkuasgfp1aTg + MO1-prmt5	standard conditions	Fig. 5 from Quillien et al., 2021
thymus EGFP expression decreased amount, abnormal	mu271Tg/mu271Tg; sd32Tg/sd32Tg + MO1-prmt5	standard conditions	Fig 1 , Fig 2 from Quillien et al., 2021

Citations