Morpholino

MO2-tgfb3

ID

ZDB-MRPHLNO-110929-7

Name

MO2-tgfb3

Previous Names

e1i1-MO (1)

Target

tgfb3 (1)

Sequence

5' - CATCATCCCTAAGGGAAACTTACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tgfb3

Expressed Gene	Anatomy	Figures
dlc	artery	Fig. 3 from Monteiro et al., 2016
dll4	artery	Fig. 3 from Monteiro et al., 2016
efnb2a	artery	Fig. 3 from Monteiro et al., 2016
gata2b	ventral wall of dorsal aorta	Fig. 3 from Monteiro et al., 2016
kdrl	vascular endothelium	Fig. 3 from Monteiro et al., 2016
rag1	(not) thymus T cell	Fig. 3 from Monteiro et al., 2016
runx1	ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. 3 from Monteiro et al., 2016

Phenotype

Phenotype resulting from MO2-tgfb3

Phenotype	Fish	Figures
basihyal cartilage aplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
head decreased size, abnormal	SING + MO2-tgfb3	Fig. 1 from Cheah et al., 2010
heart decreased size, abnormal	SING + MO2-tgfb3	Fig. 1 from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
mouth ventrally rotated head, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
neurocranium decreased size, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
pericardium increased size, abnormal	SING + MO2-tgfb3	Fig. 1 from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal	SING + MO2-tgfb3	Fig. S1 from Cheah et al., 2010
thymus T cell rag1 expression absent, abnormal	WT + MO2-tgfb3	Fig. 3 from Monteiro et al., 2016
ventral mandibular arch malformed, abnormal	SING + MO2-tgfb3	Fig. 1 from Cheah et al., 2010
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal	WT + MO2-tgfb3	Fig. 3 from Monteiro et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg; s843Tg + MO2-tgfb3	Fig. 3 from Monteiro et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO2-tgfb3	Fig. 3 from Monteiro et al., 2016

Phenotype of all Fish created by or utilizing MO2-tgfb3

Phenotype	Fish	Conditions	Figures
maxilla ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
ceratohyal bone ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
cleithrum ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
mouth ventrally rotated head, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
opercle ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
hyomandibula ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
parasphenoid ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
notochordal ossification ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
pericardium increased size, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
heart decreased size, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
branchiostegal ray osteoblast poorly differentiated, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 5 from Cheah et al., 2010
quadrate ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
opercle osteoblast poorly differentiated, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 5 from Cheah et al., 2010
basihyal cartilage aplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
cartilage development process quality, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 3 from Cheah et al., 2010
head decreased size, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
entopterygoid ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
ventral mandibular arch malformed, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
branchiostegal ray ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
vertebra ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
ceratobranchial 5 bone ossified, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 4 from Cheah et al., 2010
neurocranium decreased size, abnormal	SING + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 2 from Cheah et al., 2010
ventral mandibular arch malformed, abnormal	SING + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
neurocranium decreased size, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
heart decreased size, abnormal	SING + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
basihyal cartilage aplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
head decreased size, abnormal	SING + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
pericardium increased size, abnormal	SING + MO2-tgfb3	standard conditions	Fig. 1 from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
mouth ventrally rotated head, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal	SING + MO2-tgfb3	standard conditions	Fig. S1 from Cheah et al., 2010
ventral wall of dorsal aorta gata2b expression decreased amount, abnormal	WT + MO2-tgfb3	standard conditions	Fig. 3 from Monteiro et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO2-tgfb3	standard conditions	Fig. 3 from Monteiro et al., 2016
thymus T cell rag1 expression absent, abnormal	WT + MO2-tgfb3	standard conditions	Fig. 3 from Monteiro et al., 2016
apoptotic process increased occurrence, abnormal	y1Tg + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 7 from Cheah et al., 2010
pharyngeal arch apoptotic, abnormal	y1Tg + MO1-tgfb3 + MO2-tgfb3	standard conditions	Fig. 7 from Cheah et al., 2010
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg; s843Tg + MO2-tgfb3	standard conditions	Fig. 3 from Monteiro et al., 2016

Citations