Morpholino

MO1-nphp4

ID
ZDB-MRPHLNO-110808-1
Name
MO1-nphp4
Previous Names
  • N4ATG-Mo (1)
Target
Sequence
5' - GCGCTTCTCCACTCAGACATCAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp4
Expressed Gene Anatomy Figures
spaw Fig. S2 from Burcklé et al., 2011
Phenotype
Phenotype resulting from MO1-nphp4
Phenotype Fish Figures
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
cloaca dilated, abnormal hsc5Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
cloaca development disrupted, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber cystic, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 Fig. 3,  Fig. 7 from Burcklé et al., 2011
cloacal chamber dilated, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber cilium absent, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased amount, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased mobility, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
convergent extension process quality, abnormal WT + MO1-nphp4 Fig. 1 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 Fig. 4 from Burcklé et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp4 text only from Burcklé et al., 2011
heart looping disrupted, abnormal WT + MO1-nphp4 text only from Burcklé et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephric duct increased thickness, abnormal zf106Tg + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
pronephric glomerulus dilated, abnormal li1Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
pronephros cystic, abnormal zf106Tg + MO1-nphp4 Fig. 4,  Fig. 7 from Burcklé et al., 2011
Fig. 2 from Slanchev et al., 2011
pronephros obstructed, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephros cilium decreased length, abnormal hsc5Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
pronephros proximal region dilated, abnormal li1Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
retina layer formation disrupted, abnormal WT + MO1-nphp4 Fig. S2 from Burcklé et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
whole organism increased curvature, abnormal WT + MO1-nphp4 Fig. 6 from Borgal et al., 2012
Phenotype of all Fish created by or utilizing MO1-nphp4
Phenotype Fish Conditions Figures
pronephric duct cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
cloaca development disrupted, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber dilated, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
convergent extension process quality, abnormal WT + MO1-nphp4 standard conditions Fig. 1 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
cloacal chamber cystic, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
whole organism increased curvature, abnormal WT + MO1-nphp4 standard conditions Fig. 6 from Borgal et al., 2012
retina layer formation disrupted, abnormal WT + MO1-nphp4 standard conditions Fig. S2 from Burcklé et al., 2011
cloacal chamber cilium absent, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
pronephros obstructed, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber cilium decreased mobility, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
heart looping disrupted, abnormal WT + MO1-nphp4 standard conditions text only from Burcklé et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp4 standard conditions text only from Burcklé et al., 2011
cloacal chamber cilium decreased amount, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cilium length, ameliorated hsc5Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
cloaca morphology, ameliorated hsc5Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephros cilium decreased length, abnormal hsc5Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
cloaca dilated, abnormal hsc5Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephric glomerulus morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephric glomerulus dilated, abnormal li1Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephros proximal region dilated, abnormal li1Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephros proximal region morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephros proximal region morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E2 Fig. S12 from Garcia et al., 2022
pronephric glomerulus morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E2 Fig. S12 from Garcia et al., 2022
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3,  Fig. 7 from Burcklé et al., 2011
pronephros cystic, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 4,  Fig. 7 from Burcklé et al., 2011
pronephric duct increased thickness, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal vangl2m209/m209 + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
whole organism increased curvature, abnormal WT + MO1-jade1 + MO1-nphp4 standard conditions Fig. 6 from Borgal et al., 2012
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO1-scrib standard conditions Fig. 4 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-vangl2 standard conditions Fig. 4 from Burcklé et al., 2011
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal zf106Tg + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased height, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased amount, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
pronephric glomerulus swollen, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
pronephros cystic, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
heart looping decreased process quality, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.