Morpholino

MO1-nphp4

ID
ZDB-MRPHLNO-110808-1
Name
MO1-nphp4
Previous Names
  • N4ATG-Mo (1)
Target
Sequence
5' - GCGCTTCTCCACTCAGACATCAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp4
Expressed Gene Anatomy Figures
spaw Fig. S2 from Burcklé et al., 2011
Phenotype
Phenotype resulting from MO1-nphp4
Phenotype Fish Figures
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
cloaca dilated, abnormal hsc5Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
cloaca development disrupted, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber cystic, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 Fig. 3Fig. 7 from Burcklé et al., 2011
cloacal chamber dilated, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
cloacal chamber cilium absent, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased amount, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased mobility, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
convergent extension process quality, abnormal WT + MO1-nphp4 Fig. 1 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 Fig. 4 from Burcklé et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp4 text only from Burcklé et al., 2011
heart looping disrupted, abnormal WT + MO1-nphp4 text only from Burcklé et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephric duct increased thickness, abnormal zf106Tg + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO1-nphp4 Fig. 2 from Burcklé et al., 2011
pronephric glomerulus dilated, abnormal li1Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
pronephros cystic, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 4Fig. 7 from Burcklé et al., 2011
Fig. 2 from Slanchev et al., 2011
pronephros obstructed, abnormal WT + MO1-nphp4 Fig. 3 from Burcklé et al., 2011
pronephros cilium decreased length, abnormal hsc5Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
pronephros proximal region dilated, abnormal li1Tg + MO1-nphp4 Fig. S12 from Garcia et al., 2022
retina layer formation disrupted, abnormal WT + MO1-nphp4 Fig. S2 from Burcklé et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
whole organism increased curvature, abnormal WT + MO1-nphp4 Fig. 6 from Borgal et al., 2012
Phenotype of all Fish created by or utilizing MO1-nphp4
Phenotype Fish Conditions Figures
pronephric duct cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
cloaca development disrupted, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber dilated, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
convergent extension process quality, abnormal WT + MO1-nphp4 standard conditions Fig. 1 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
cloacal chamber cystic, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
whole organism increased curvature, abnormal WT + MO1-nphp4 standard conditions Fig. 6 from Borgal et al., 2012
cloacal chamber cilium absent, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
retina layer formation disrupted, abnormal WT + MO1-nphp4 standard conditions Fig. S2 from Burcklé et al., 2011
pronephros obstructed, abnormal WT + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber cilium decreased mobility, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
heart looping disrupted, abnormal WT + MO1-nphp4 standard conditions text only from Burcklé et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp4 standard conditions text only from Burcklé et al., 2011
cloacal chamber cilium decreased amount, abnormal WT + MO1-nphp4 standard conditions Fig. 2 from Burcklé et al., 2011
pericardium edematous, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
brain hydrophilic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO1-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephros cilium length, ameliorated hsc5Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
cloaca morphology, ameliorated hsc5Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephros cilium decreased length, abnormal hsc5Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
cloaca dilated, abnormal hsc5Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephric glomerulus morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephric glomerulus dilated, abnormal li1Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephros proximal region dilated, abnormal li1Tg + MO1-nphp4 control Fig. S12 from Garcia et al., 2022
pronephros proximal region morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E1 Fig. S12 from Garcia et al., 2022
pronephros proximal region morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E2 Fig. S12 from Garcia et al., 2022
pronephric glomerulus morphology, ameliorated li1Tg + MO1-nphp4 chemical treatment by environment: prostaglandin E2 Fig. S12 from Garcia et al., 2022
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3Fig. 7 from Burcklé et al., 2011
pronephros cystic, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 4Fig. 7 from Burcklé et al., 2011
pronephric duct increased thickness, abnormal zf106Tg + MO1-nphp4 standard conditions Fig. 3 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal vangl2m209/m209 + MO1-nphp4 standard conditions Fig. 4 from Burcklé et al., 2011
whole organism increased curvature, abnormal WT + MO1-jade1 + MO1-nphp4 standard conditions Fig. 6 from Borgal et al., 2012
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-prickle1a standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal WT + MO1-nphp4 + MO1-scrib standard conditions Fig. 4 from Burcklé et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-nphp4 + MO1-vangl2 standard conditions Fig. 4 from Burcklé et al., 2011
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO1-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart looping decreased process quality, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephric glomerulus swollen, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
heart structure, abnormal li1Tg + MO1-nphp4 + MO2-tmem218 + MO4-tp53 (AB/TL) control Fig. 5 from Epting et al., 2022
pronephros cystic, abnormal zf106Tg + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO1-nphp4 + MO1-prickle2b standard conditions Fig. 4 from Burcklé et al., 2011
pronephros cystic, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased height, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber cell increased amount, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
cloacal chamber deformed, abnormal zf106Tg + MO1-nphp4 + MO2-invs standard conditions Fig. 7 from Burcklé et al., 2011
pronephric glomerulus swollen, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
pronephros cystic, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
heart looping decreased process quality, abnormal tmem218zf3603/zf3603; li1Tg + MO1-nphp4 + MO4-tp53 (AB/TL) control Fig. 6 from Epting et al., 2022
Citations