Morpholino
MO1-tlr4ba
- ID
- ZDB-MRPHLNO-110426-1
- Name
- MO1-tlr4ba
- Previous Names
- None
- Target
- Sequence
-
5' - GATGCTGCTGAGGTTTCTTCCCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tlr4ba
No data available
Phenotype
Phenotype resulting from MO1-tlr4ba
No data available
Phenotype of all Fish created by or utilizing MO1-tlr4ba
1 - 4 of 4
Citations
- Zhang, Z., Zhang, H.L., Yang, D.H., Hao, Q., Yang, H.W., Meng, D.L., Meindert de Vos, W., Guan, L.L., Liu, S.B., Teame, T., Gao, C.C., Ran, C., Yang, Y.L., Yao, Y.Y., Ding, Q.W., Zhou, Z.G. (2024) Lactobacillus rhamnosus GG triggers intestinal epithelium injury in zebrafish revealing host dependent beneficial effects. iMeta. 3:e181e181
- Zhang, Z., Ran, C., Ding, Q.W., Liu, H.L., Xie, M.X., Yang, Y.L., Xie, Y.D., Gao, C.C., Zhang, H.L., Zhou, Z.G. (2019) Ability of prebiotic polysaccharides to activate a HIF1α-antimicrobial peptide axis determines liver injury risk in zebrafish. Communications biology. 2:274
- Sepulcre, M.P., Alcaraz-Pérez, F., López-Muñoz, A., Roca, F.J., Meseguer, J., Cayuela, M.L., and Mulero, V. (2009) Evolution of lipopolysaccharide (LPS) recognition and signaling: fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. Journal of immunology (Baltimore, Md. : 1950). 182(4):1836-1845
1 - 3 of 3
Show