Morpholino

MO2-bag3

ID

ZDB-MRPHLNO-110321-7

Name

MO2-bag3

Previous Names

None

Target

bag3 (1)

Sequence

5' - GCTTTCTCATGATCTTACCTCAGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO, targets splice donor sites of exon 2.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-bag3

Expressed Gene	Anatomy	Figures
bag3	whole organism	Fig 5 from Diofano et al., 2020

Phenotype

Phenotype resulting from MO2-bag3

Phenotype	Fish	Figures
cardiac muscle structure, abnormal	WT + MO2-bag3	Fig 3 from Diofano et al., 2020
heart contraction decreased frequency, abnormal	bag3^ulm104/+ + MO2-bag3	Fig 3 , Fig 4 from Diofano et al., 2020
heart contraction decreased magnitude, abnormal	WT + MO2-bag3	Fig 3 , Fig 4 from Diofano et al., 2020
heart contraction disrupted, abnormal	AB/TU + MO2-bag3	Fig. 3 from Norton et al., 2011
locomotion disrupted, abnormal	WT + MO2-bag3	Fig. 2 from Bührdel et al., 2015
pericardium edematous, abnormal	WT + MO2-bag3	Fig. S4 from Bührdel et al., 2015 Fig. 3 from Norton et al., 2011
response to mechanical stimulus decreased magnitude, abnormal	bag3^ulm104/+ + MO2-bag3	Fig 3 , Fig 4 from Diofano et al., 2020
skeletal muscle malformed, abnormal	bag3^ulm104/+ + MO2-bag3	Fig 4 from Diofano et al., 2020
skeletal muscle refractivity, abnormal	WT + MO2-bag3	Fig. S4 from Bührdel et al., 2015
skeletal muscle structure, abnormal	WT + MO2-bag3	Fig 3 , Fig 4 from Diofano et al., 2020
thigmotaxis disrupted, abnormal	WT + MO2-bag3	Fig. 2 from Bührdel et al., 2015
trunk curved, abnormal	WT + MO2-bag3	Fig. S4 from Bührdel et al., 2015 Fig. 3 from Norton et al., 2011
whole organism decreased mobility, abnormal	WT + MO2-bag3	Fig. 2 from Bührdel et al., 2015

Phenotype of all Fish created by or utilizing MO2-bag3

Phenotype	Fish	Conditions	Figures
heart contraction disrupted, abnormal	AB/TU + MO2-bag3	standard conditions	Fig. 3 from Norton et al., 2011
pericardium edematous, abnormal	AB/TU + MO2-bag3	standard conditions	Fig. 3 from Norton et al., 2011
trunk curved, abnormal	AB/TU + MO2-bag3	standard conditions	Fig. 3 from Norton et al., 2011
heart contraction decreased magnitude, abnormal	WT + MO2-bag3	standard conditions	Fig 3 , Fig 4 from Diofano et al., 2020
skeletal muscle refractivity, abnormal	WT + MO2-bag3	standard conditions	Fig. S4 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO2-bag3	standard conditions	Fig. 2 from Bührdel et al., 2015
heart contraction decreased frequency, abnormal	WT + MO2-bag3	standard conditions	Fig 3 , Fig 4 from Diofano et al., 2020
pericardium edematous, abnormal	WT + MO2-bag3	standard conditions	Fig. S4 from Bührdel et al., 2015
locomotion disrupted, abnormal	WT + MO2-bag3	standard conditions	Fig. 2 from Bührdel et al., 2015
cardiac muscle structure, abnormal	WT + MO2-bag3	standard conditions	Fig 3 from Diofano et al., 2020
thigmotaxis disrupted, abnormal	WT + MO2-bag3	standard conditions	Fig. 2 from Bührdel et al., 2015
response to mechanical stimulus decreased magnitude, abnormal	WT + MO2-bag3	standard conditions	Fig 3 , Fig 4 from Diofano et al., 2020
skeletal muscle structure, abnormal	WT + MO2-bag3	standard conditions	Fig 3 , Fig 4 from Diofano et al., 2020
trunk curved, abnormal	WT + MO2-bag3	standard conditions	Fig. S4 from Bührdel et al., 2015
skeletal muscle malformed, abnormal	WT + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020
skeletal muscle structure, abnormal	bag3^ulm104/+ + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020
heart contraction decreased magnitude, abnormal	bag3^ulm104/+ + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020
response to mechanical stimulus decreased magnitude, abnormal	bag3^ulm104/+ + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020
skeletal muscle malformed, abnormal	bag3^ulm104/+ + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020
heart contraction decreased frequency, abnormal	bag3^ulm104/+ + MO2-bag3	standard conditions	Fig 4 from Diofano et al., 2020

Citations