Morpholino

MO1-faf1

ID
ZDB-MRPHLNO-110221-1
Name
MO1-faf1
Previous Names
  • faf1-MO-ATG (1)
Target
Sequence
5' - TGTCCATGTTGCTGTCGGAGGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-faf1
Expressed Gene Anatomy Figures
dlx2a Fig. S7 from Ghassibe-Sabbagh et al., 2011
snai1b Fig. S7 from Ghassibe-Sabbagh et al., 2011
sox10 Fig. S7 from Ghassibe-Sabbagh et al., 2011
Phenotype
Phenotype resulting from MO1-faf1
Phenotype Fish Figures
basihyal cartilage decreased length, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratobranchial cartilage decreased amount, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
Meckel's cartilage mislocalised ventrally, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 + MO5-tp53 Fig. 2,  Fig. S5 from Ghassibe-Sabbagh et al., 2011
Phenotype of all Fish created by or utilizing MO1-faf1
Phenotype Fish Conditions Figures
Meckel's cartilage mislocalised ventrally, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 standard conditions Fig. 2,  Fig. S5 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
ceratobranchial cartilage decreased amount, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
basihyal cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.