Morpholino

MO1-faf1

ID
ZDB-MRPHLNO-110221-1
Name
MO1-faf1
Previous Names
  • faf1-MO-ATG (1)
Target
Sequence
5' - TGTCCATGTTGCTGTCGGAGGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-faf1
Phenotype
Phenotype resulting from MO1-faf1
Phenotype Fish Figures
basihyal cartilage decreased length, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratobranchial cartilage decreased amount, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
Meckel's cartilage mislocalised ventrally, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal WT + MO1-faf1 Fig. 2 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal WT + MO1-faf1 Fig. S5 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO1-faf1 + MO5-tp53 Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 + MO5-tp53 Fig. 2Fig. S5 from Ghassibe-Sabbagh et al., 2011
Phenotype of all Fish created by or utilizing MO1-faf1
Phenotype Fish Conditions Figures
Meckel's cartilage mislocalised ventrally, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 standard conditions Fig. 2Fig. S5 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal WT + MO1-faf1 standard conditions Fig. S5 from Ghassibe-Sabbagh et al., 2011
ceratobranchial cartilage decreased amount, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
basihyal cartilage decreased length, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal WT + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal y1Tg + MO1-faf1 + MO5-tp53 standard conditions Fig. 2 from Ghassibe-Sabbagh et al., 2011
Citations