Morpholino

MO4-alcama

ID
ZDB-MRPHLNO-110125-5
Name
MO4-alcama
Previous Names
  • SB MO (1)
Target
Sequence
5' - GCAGTCCCTCACCTTAATGTTAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-alcama
Expressed Gene Anatomy Figures
alcama Fig. 1 with image from Choudhry et al., 2011
dlx3b Fig. 4 with image from Choudhry et al., 2011
dlx5a Fig. 4 with image from Choudhry et al., 2011
dlx6a Fig. 4 with image from Choudhry et al., 2011
edn1 Fig. 3 with image from Choudhry et al., 2011
hand2 Fig. 4 with image from Choudhry et al., 2011
nkx3-2 Fig. 4 with image from Choudhry et al., 2011
Phenotype
Phenotype resulting from MO4-alcama
Phenotype Fish Figures
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal WT + MO4-alcama Fig. 2 with image from Choudhry et al., 2011
interhyal cartilage absent, abnormal WT + MO4-alcama Fig. 2 with image from Choudhry et al., 2011
Meckel's cartilage bent, abnormal WT + MO4-alcama Fig. 1 with image,  Fig. 2 with image from Choudhry et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO4-alcama Fig. 2 with image from Choudhry et al., 2011
Meckel's cartilage protruding, abnormal WT + MO4-alcama Fig. 1 with image from Choudhry et al., 2011
pericardium edematous, abnormal WT + MO4-alcama Fig. 1 with image from Choudhry et al., 2011
splanchnocranium decreased length, abnormal WT + MO4-alcama Fig. 1 with image from Choudhry et al., 2011
swim bladder absent, abnormal WT + MO4-alcama Fig. 1 with image from Choudhry et al., 2011
ventral mandibular arch decreased length, abnormal WT + MO4-alcama Fig. 1 with image from Choudhry et al., 2011
Phenotype of all Fish created by or utilizing MO4-alcama
Phenotype Fish Conditions Figures
Meckel's cartilage bent, abnormal WT + MO4-alcama standard conditions Fig. 1 with image,  Fig. 2 with image from Choudhry et al., 2011
pericardium edematous, abnormal WT + MO4-alcama standard conditions Fig. 1 with image from Choudhry et al., 2011
swim bladder absent, abnormal WT + MO4-alcama standard conditions Fig. 1 with image from Choudhry et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO4-alcama standard conditions Fig. 2 with image from Choudhry et al., 2011
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal WT + MO4-alcama standard conditions Fig. 2 with image from Choudhry et al., 2011
interhyal cartilage absent, abnormal WT + MO4-alcama standard conditions Fig. 2 with image from Choudhry et al., 2011
ventral mandibular arch decreased length, abnormal WT + MO4-alcama standard conditions Fig. 1 with image from Choudhry et al., 2011
Meckel's cartilage protruding, abnormal WT + MO4-alcama standard conditions Fig. 1 with image from Choudhry et al., 2011
splanchnocranium decreased length, abnormal WT + MO4-alcama standard conditions Fig. 1 with image from Choudhry et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.