Morpholino
MO3-mcamb
- ID
- ZDB-MRPHLNO-101216-2
- Name
- MO3-mcamb
- Previous Names
-
- gicerin MO (1)
- Target
- Sequence
-
5' - AGCAGTGCGGTGTAGGTCATTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mcamb
Expressed Gene | Anatomy | Figures |
---|---|---|
aplnra |
Fig. 5 ![]() |
|
axin2 |
Fig. 6
from Ye et al., 2013 |
|
ctslb |
Fig. 5
from Ye et al., 2013 |
|
dharma |
Fig. 6
from Ye et al., 2013 |
|
dll4 |
Fig. 5 ![]() |
1 - 5 of 24 Show all
Phenotype
Phenotype resulting from MO3-mcamb
1 - 5 of 59 Show all
Phenotype of all Fish created by or utilizing MO3-mcamb
1 - 5 of 61 Show all
Citations
- Gao, Q., Zhang, J., Wang, X., Liu, Y., He, R., Liu, X., Wang, F., Feng, J., Yang, D., Wang, Z., Meng, A., Yan, X. (2017) The signalling receptor MCAM coordinates apical-basal polarity and planar cell polarity during morphogenesis. Nature communications. 8:15279
- Yan, H., Zhang, C., Wang, Z., Tu, T., Duan, H., Luo, Y., Feng, J., Liu, F., Yan, X. (2017) CD146 is required for VEGF-C-induced lymphatic sprouting during lymphangiogenesis. Scientific Reports. 7:7442
- Tu, T., Zhang, C., Yan, H., Luo, Y., Kong, R., Wen, P., Ye, Z., Chen, J., Feng, J., Liu, F., Wu, J.Y., Yan, X. (2015) CD146 acts as a novel receptor for netrin-1 in promoting angiogenesis and vascular development. Cell Research. 25(3):275-87
- Ye, Z., Zhang, C., Tu, T., Sun, M., Liu, D., Lu, D., Feng, J., Yang, D., Liu, F., and Yan, X. (2013) Wnt5a uses CD146 as a receptor to regulate cell motility and convergent extension. Nature communications. 4:2803
- So, J.H., Hong, S.K., Kim, H.T., Jung, S.H., Lee, M.S., Choi, J.H., Bae, Y.K., Kudoh, T., Kim, J.H., and Kim, C.H. (2010) Gicerin/Cd146 is involved in zebrafish cardiovascular development and tumor angiogenesis. Genes to cells : devoted to molecular & cellular mechanisms. 15(11):1099-1110
1 - 5 of 5
Show