Morpholino

MO1-hoxa13a

ID

ZDB-MRPHLNO-101108-1

Name

MO1-hoxa13a

Previous Names

None

Target

Sequence

5' - GGCGGAGAAGTAGTGACGTTGTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hoxa13a

No data available

Phenotype

Phenotype resulting from MO1-hoxa13a

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
cellular pigmentation disrupted, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
extension aplastic, abnormal	WT + MO1-hoxa13a	Fig. 6, text only from Crow et al., 2009
head decreased size, abnormal	WT + MO1-hoxa13a	Fig. 6, text only from Crow et al., 2009
median fin fold aplastic, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
melanocyte disorganized, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
neuromast absent, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
notochord posterior side disorganized, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
pectoral fin development disrupted, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
pericardium edematous, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009
post-vent region bent, abnormal	WT + MO1-hoxa13a	Fig. 6, text only from Crow et al., 2009
whole organism decreased width, abnormal	WT + MO1-hoxa13a	text only from Crow et al., 2009

Phenotype of all Fish created by or utilizing MO1-hoxa13a

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	WT + MO1-hoxa13a	standard conditions	Fig. 6, text only from Crow et al., 2009
cellular pigmentation disrupted, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
extension aplastic, abnormal	WT + MO1-hoxa13a	standard conditions	Fig. 6, text only from Crow et al., 2009
notochord posterior side disorganized, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
median fin fold aplastic, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
post-vent region bent, abnormal	WT + MO1-hoxa13a	standard conditions	Fig. 6, text only from Crow et al., 2009
pericardium edematous, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
pectoral fin development disrupted, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
blood circulation disrupted, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
neuromast absent, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
melanocyte disorganized, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009
whole organism decreased width, abnormal	WT + MO1-hoxa13a	standard conditions	text only from Crow et al., 2009

Citations