Morpholino

MO3-itgb1b

ID

ZDB-MRPHLNO-101103-2

Name

MO3-itgb1b

Previous Names

β1bEl10 (1)

Target

itgb1b (1)

Sequence

5' - GCCAGTTTGAGTGAATAACTCACCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-itgb1b

Expressed Gene	Anatomy	Figures
sox32	forerunner cell group	Fig. 4 from Ablooglu et al., 2010
spaw	lateral plate mesoderm right side	Fig. 4 from Ablooglu et al., 2010
tbxta	axis forerunner cell group	Fig. 4 from Ablooglu et al., 2010

Phenotype

Phenotype resulting from MO3-itgb1b

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
forerunner cell group circular, abnormal	ha01Tg + MO3-itgb1b	Fig. 5 from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal	ha01Tg + MO3-itgb1b	Fig. 5 from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal	ha01Tg + MO3-itgb1b	Fig. 5 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	WT + MO3-itgb1b	Fig. 4 , Fig. 5 from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal	ha01Tg + MO3-itgb1b	Fig. 5 from Ablooglu et al., 2010
head morphology, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
heart tube positional polarity, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO3-itgb1b	Fig. 7 from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal	ha01Tg + MO3-itgb1b	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	ha01Tg + MO3-itgb1b	Fig. 7 , Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal	ha01Tg + MO3-itgb1b	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal	ha01Tg + MO3-itgb1b	Fig. 8 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
post-vent region undulate, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
somite U-shaped, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal	WT + MO3-itgb1b	Fig. 4 from Ablooglu et al., 2010

Phenotype of all Fish created by or utilizing MO3-itgb1b

Phenotype	Fish	Conditions	Figures
forerunner cell group spatial pattern, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 7 from Ablooglu et al., 2010
post-vent region undulate, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
heart tube positional polarity, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
somite U-shaped, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 7 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
head morphology, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal	WT + MO3-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 5 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 8 from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group circular, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 5 from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 8 from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	ha01Tg + MO3-itgb1b	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group mislocalised, abnormal	AB + MO1-wdr18 + MO3-itgb1b	standard conditions	Fig. 7 from Gao et al., 2011
determination of left/right symmetry disrupted, abnormal	AB + MO1-wdr18 + MO3-itgb1b	standard conditions	Fig. 7 from Gao et al., 2011

Citations