Morpholino

MO3-ppp1r12a

ID
ZDB-MRPHLNO-101006-1
Name
MO3-ppp1r12a
Previous Names
  • mypt1 MO (1)
Target
Sequence
5' - GGCGTCCGCCATCTTCATCCCCTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ppp1r12a
Expressed Gene Anatomy Figures
ppp1r12a Fig. 1 with image from Weiser et al., 2009
Phenotype
Phenotype resulting from MO3-ppp1r12a
Phenotype Fish Figures
anterior axial hypoblast bleb increased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
axis decreased length, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
cytoskeleton organization increased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
mesodermal cell bleb increased amount, abnormal WIK/AB + MO3-ppp1r12a Fig. 5 with image,  Fig. 6 with image from Weiser et al., 2009
notochord increased width, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
notochord mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
prechordal plate formation decreased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
segmental plate mesodermal cell decreased cellular motility, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
segmental plate mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
whole organism ppp1r12a expression decreased amount, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
whole organism anterior-posterior axis truncated, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
Phenotype of all Fish created by or utilizing MO3-ppp1r12a
Phenotype Fish Conditions Figures
notochord increased width, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
whole organism anterior-posterior axis truncated, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
whole organism ppp1r12a expression decreased amount, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
axis decreased length, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
mesodermal cell bleb increased amount, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 5 with image,  Fig. 6 with image from Weiser et al., 2009
segmental plate mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
notochord mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
convergent extension involved in axis elongation disrupted, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
segmental plate mesodermal cell decreased cellular motility, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
mesodermal cell bleb normal amount, ameliorated WIK/AB + MO3-ppp1r12a chemical treatment by environment: blebbistatin Fig. 6 with image from Weiser et al., 2009
cytoskeleton organization increased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
prechordal plate formation decreased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast bleb increased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
gastrulation process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
axis elongation decreased process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.