Morpholino

MO2-cldn5a

ID

ZDB-MRPHLNO-100525-1

Name

MO2-cldn5a

Previous Names

None

Target

cldn5a (1)

Sequence

5' - AGGCCATCGCTTTCTTTTCCCACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cldn5a

Expressed Gene	Anatomy	Figures
cdh5	dorsal aorta blood vessel endothelial cell posterior cardinal vein blood vessel endothelial cell vascular cord blood vessel endothelial cell	Fig. 5 from Yang et al., 2020

Phenotype

Phenotype resulting from MO2-cldn5a

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	TU + MO2-cldn5a	Fig. S4 from Kim et al., 2017
dorsal aorta ab1-cldn5 labeling absent, abnormal	WT + MO2-cldn5a	Fig. 5 from Yang et al., 2020
dorsal aorta decreased diameter, abnormal	WT + MO2-cldn5a	Fig. 3 from Yang et al., 2020
dorsal aorta unlumenized, abnormal	WT + MO2-cldn5a	Fig. 3 from Yang et al., 2020
dorsal aorta blood vessel endothelial cell migration increased occurrence, abnormal	y7Tg + MO2-cldn5a	Fig. 4 from Yang et al., 2020
dorsal aorta blood vessel lumenization decreased process quality, abnormal	WT + MO2-cldn5a	Fig. 3 from Yang et al., 2020
establishment of endothelial barrier disrupted, abnormal	lri500Tg; s896Tg + MO2-cldn5a	Fig. S6 from Xie et al., 2010
fourth ventricle decreased volume, abnormal	AB + MO2-cldn5a + MO4-tp53	Fig. 3 from Zhang et al., 2010
heart tube mislocalised, abnormal	TU + MO2-cldn5a	Fig. S4 from Kim et al., 2017
hyaloid vessel broken, abnormal	lri500Tg; s896Tg + MO2-cldn5a	Fig. S6 from Xie et al., 2010
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal	s870Tg + MO2-cldn5a	Fig. S2 from Kim et al., 2017
neuroepithelial cell bicellular tight junction increased permeability, abnormal	AB + MO2-cldn5a	Fig. 1 from Zhang et al., 2010
tectal ventricle decreased volume, abnormal	AB + MO2-cldn5a + MO4-tp53	Fig. 3 from Zhang et al., 2010
ventricular system lumenized, abnormal	AB + MO2-cldn5a + MO4-tp53	Fig. 3 from Zhang et al., 2010
ventricular system development disrupted, abnormal	AB + MO2-cldn5a	Fig. 3 from Zhang et al., 2010

Phenotype of all Fish created by or utilizing MO2-cldn5a

Phenotype	Fish	Conditions	Figures
tectal ventricle decreased volume, abnormal	AB + MO2-cldn5a	standard conditions	Fig. 3 from Zhang et al., 2010
ventricular system lumenized, abnormal	AB + MO2-cldn5a	standard conditions	Fig. 3 from Zhang et al., 2010
ventricular system development disrupted, abnormal	AB + MO2-cldn5a	standard conditions	Fig. 3 from Zhang et al., 2010
fourth ventricle decreased volume, abnormal	AB + MO2-cldn5a	standard conditions	Fig. 3 from Zhang et al., 2010
neuroepithelial cell bicellular tight junction increased permeability, abnormal	AB + MO2-cldn5a	standard conditions	Fig. 1 from Zhang et al., 2010
ventricular system development disrupted, abnormal	AB + MO2-cldn5a + MO4-tp53	standard conditions	Fig. 3 from Zhang et al., 2010
fourth ventricle decreased volume, abnormal	AB + MO2-cldn5a + MO4-tp53	standard conditions	Fig. 3 from Zhang et al., 2010
ventricular system lumenized, abnormal	AB + MO2-cldn5a + MO4-tp53	standard conditions	Fig. 3 from Zhang et al., 2010
tectal ventricle decreased volume, abnormal	AB + MO2-cldn5a + MO4-tp53	standard conditions	Fig. 3 from Zhang et al., 2010
determination of heart left/right asymmetry disrupted, abnormal	TU + MO2-cldn5a	standard conditions	Fig. S4 from Kim et al., 2017
heart tube mislocalised, abnormal	TU + MO2-cldn5a	standard conditions	Fig. S4 from Kim et al., 2017
dorsal aorta unlumenized, abnormal	WT + MO2-cldn5a	standard conditions	Fig. 3 from Yang et al., 2020
dorsal aorta ab1-cldn5 labeling absent, abnormal	WT + MO2-cldn5a	standard conditions	Fig. 5 from Yang et al., 2020
dorsal aorta decreased diameter, abnormal	WT + MO2-cldn5a	standard conditions	Fig. 3 from Yang et al., 2020
dorsal aorta blood vessel lumenization decreased process quality, abnormal	WT + MO2-cldn5a	standard conditions	Fig. 3 from Yang et al., 2020
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal	s870Tg + MO2-cldn5a	standard conditions	Fig. S2 from Kim et al., 2017
dorsal aorta blood vessel endothelial cell migration increased occurrence, abnormal	y7Tg + MO2-cldn5a	standard conditions	Fig. 4 from Yang et al., 2020
hyaloid vessel broken, abnormal	lri500Tg; s896Tg + MO2-cldn5a	standard conditions	Fig. S6 from Xie et al., 2010
establishment of endothelial barrier disrupted, abnormal	lri500Tg; s896Tg + MO2-cldn5a	standard conditions	Fig. S6 from Xie et al., 2010

Citations