Morpholino
MO1-dzip1
- ID
- ZDB-MRPHLNO-100519-3
- Name
- MO1-dzip1
- Previous Names
-
- splice MO1 (1)
- Target
- Sequence
-
5' - GTACAGACCTTGTGGTAATTGGCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dzip1
No data available
Phenotype
Phenotype resulting from MO1-dzip1
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-dzip1
1 - 5 of 6 Show all
Citations
- Glazer, A., Wilkinson, A., Backer, C.B., Lapan, S., Gutzman, J.H., Cheeseman, I.M., and Reddien, P.W. (2010) The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis. Developmental Biology. 337(1):148-156
- Tay, S.Y., Yu, X., Wong, K.N., Panse, P., Ng, C.P., and Roy, S. (2010) The iguana/DZIP1 protein is a novel component of the ciliogenic pathway essential for axonemal biogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(2):527-534
- Wolff, C., Roy, S., Lewis, K.E., Schauerte, H., Joerg-Rauch, G., Kirn, A., Weiler, C., Geisler, R., Haffter, P., Ingham, P.W. (2004) iguana encodes a novel zinc-finger protein with coiled-coil domains essential for Hedgehog signal transduction in the zebrafish embryo. Genes & Development. 18(13):1565-1576
1 - 3 of 3
Show