Morpholino

MO1-esr2a

ID
ZDB-MRPHLNO-100503-20
Name
MO1-esr2a
Previous Names
None
Target
Sequence
5' - ACATGGTGAAGGCGGATGAGTTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esr2a
Expressed Gene Anatomy Figures
cldnb Fig. 6 with image from Froehlicher et al., 2009
krt15 Fig. 6 with image from Froehlicher et al., 2009
neurog1 Fig. 7 with image from Froehlicher et al., 2009
notch1a Fig. 8 with image from Froehlicher et al., 2009
notch3 Fig. 8 with image from Froehlicher et al., 2009
runx1 Fig. 2 with image from Carroll et al., 2014
Phenotype
Phenotype resulting from MO1-esr2a
Phenotype Fish Figures
hatching disrupted, abnormal WT + MO1-esr2a Fig. 2 with image from Froehlicher et al., 2009
neuromast absent, abnormal WT + MO1-esr2a Fig. 2 with image from Froehlicher et al., 2009
neuromast decreased amount, abnormal sqet4Et + MO1-esr2a Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Froehlicher et al., 2009
post-vent region increased curvature, abnormal WT + MO1-esr2a Fig. 2 with image from Froehlicher et al., 2009
ventral wall of dorsal aorta runx1 expression increased amount, abnormal WT + MO1-esr2a Fig. 2 with image from Carroll et al., 2014
whole organism circling, abnormal WT + MO1-esr2a Fig. 2 with image,  Fig. 5 with image from Froehlicher et al., 2009
whole organism dead, abnormal WT + MO1-esr2a Fig. 2 with image from Froehlicher et al., 2009
Phenotype of all Fish created by or utilizing MO1-esr2a
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-esr2a chemical treatment by environment: 17beta-estradiol Fig. 2 with image from Carroll et al., 2014
whole organism dead, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image from Froehlicher et al., 2009
neuromast absent, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image from Froehlicher et al., 2009
neuromast decreased amount, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Froehlicher et al., 2009
post-vent region increased curvature, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image from Froehlicher et al., 2009
hatching disrupted, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image from Froehlicher et al., 2009
whole organism circling, abnormal WT + MO1-esr2a standard conditions Fig. 2 with image,  Fig. 5 with image from Froehlicher et al., 2009
ventral wall of dorsal aorta runx1 expression increased amount, abnormal WT + MO1-esr2a control Fig. 2 with image from Carroll et al., 2014
neuromast decreased amount, abnormal WT + MO1-esr2a + MO4-tp53 standard conditions Fig. 4 with image from Froehlicher et al., 2009
neuromast decreased amount, abnormal sqet4Et + MO1-esr2a standard conditions Fig. 4 with image from Froehlicher et al., 2009
ventral wall of dorsal aorta runx1 expression increased amount, abnormal WT + MO1-esr2a + MO1-esr2b control Fig. 2 with image from Carroll et al., 2014
ventral wall of dorsal aorta runx1 expression amount, ameliorated WT + MO1-esr2a + MO1-esr2b chemical treatment by environment: 17beta-estradiol Fig. 2 with image from Carroll et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.