Morpholino

MO1-mysm1

ID

ZDB-MRPHLNO-100226-11

Name

MO1-mysm1

Previous Names

None

Target

Sequence

5' - CAACAACATCCAACTCATCAGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mysm1

Expressed Gene	Anatomy	Figures
elavl3	neuron	Fig. 2 from Tse et al., 2009

Phenotype

Phenotype resulting from MO1-mysm1

Phenotype	Fish	Figures
central nervous system necrotic, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
extension decreased length, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
eye malformed, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-mysm1	Fig. 2 from Tse, 2017
Meckel's cartilage morphology, abnormal	AB + MO1-mysm1	Fig. 2 from Tse, 2017
notochord malformed, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
otolith morphogenesis disrupted, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-mysm1	Fig. 2 from Tse, 2017
post-vent region curled, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009
yolk deformed, abnormal	AB + MO1-mysm1	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-mysm1

Phenotype	Fish	Conditions	Figures
Meckel's cartilage morphology, abnormal	AB + MO1-mysm1	standard conditions	Fig. 2 from Tse, 2017
yolk deformed, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-mysm1	standard conditions	Fig. 2 from Tse, 2017
notochord malformed, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-mysm1	standard conditions	Fig. 2 from Tse, 2017
head decreased size, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
otolith morphogenesis disrupted, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
extension decreased length, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009
eye malformed, abnormal	AB + MO1-mysm1	standard conditions	Fig. S4 from Tse et al., 2009

Citations