Morpholino

MO1-usp25

ID
ZDB-MRPHLNO-100217-17
Name
MO1-usp25
Previous Names
None
Target
Sequence
5' - CAGGACATTCTGCTCCACGGTCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-usp25
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Tse et al., 2009
chrd Fig. 3 with image from Tse et al., 2009
elavl3 Fig. 2 with image from Tse et al., 2009
eve1 Fig. 3 with image from Tse et al., 2009
gata1a Fig. 4 with image from Tse et al., 2009
gata2a Fig. 3 with image from Tse et al., 2009
gsc Fig. 3 with image from Tse et al., 2009
myod1 Fig. 4 with image from Tse et al., 2009
pax2a Fig. 4 with image from Tse et al., 2009
Phenotype
Phenotype resulting from MO1-usp25
Phenotype Fish Figures
central nervous system necrotic, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
ethmoid cartilage absent, abnormal AB + MO1-usp25 Fig. 4 from Tse, 2017
forebrain bulbous, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
head malformed, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO1-usp25 Fig. 4 from Tse, 2017
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp25 Fig. 4 from Tse, 2017
post-vent region necrotic, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
trunk immature, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal WT + MO1-usp25 Fig. S4 from Tse et al., 2009
Phenotype of all Fish created by or utilizing MO1-usp25
Phenotype Fish Conditions Figures
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp25 standard conditions Fig. 4 from Tse, 2017
mandibular arch skeleton decreased size, abnormal AB + MO1-usp25 standard conditions Fig. 4 from Tse, 2017
ethmoid cartilage absent, abnormal AB + MO1-usp25 standard conditions Fig. 4 from Tse, 2017
post-vent region necrotic, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
trunk immature, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
forebrain bulbous, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
head malformed, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal WT + MO1-usp25 standard conditions Fig. S4 from Tse et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.