Morpholino

MO1-cyld2

ID

ZDB-MRPHLNO-100215-2

Name

MO1-cyld2

Previous Names

Target

Sequence

5' - CATGTTGAATGGAGAGTGTTTGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cyld2

No data available

Phenotype

Phenotype resulting from MO1-cyld2

Phenotype	Fish	Figures
central nervous system necrotic, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
ethmoid cartilage shape, abnormal	AB + MO1-cyld2	Fig. 3 from Tse, 2017
eye decreased size, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal	AB + MO1-cyld2	Fig. 3 from Tse, 2017
Meckel's cartilage morphology, abnormal	AB + MO1-cyld2	Fig. 3 from Tse, 2017
pericardium edematous, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal	AB + MO1-cyld2	Fig. 3 from Tse, 2017
trunk bent, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
trunk necrotic, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal	AB + MO1-cyld2	Fig. S4 from Tse et al., 2009

Phenotype of all Fish created by or utilizing MO1-cyld2

Phenotype	Fish	Conditions	Figures
mandibular arch skeleton decreased size, abnormal	AB + MO1-cyld2	standard conditions	Fig. 3 from Tse, 2017
pharyngeal arch cartilage malformed, abnormal	AB + MO1-cyld2	standard conditions	Fig. 3 from Tse, 2017
pericardium edematous, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
trunk bent, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
Meckel's cartilage morphology, abnormal	AB + MO1-cyld2	standard conditions	Fig. 3 from Tse, 2017
whole organism decreased size, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
head decreased size, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
ethmoid cartilage shape, abnormal	AB + MO1-cyld2	standard conditions	Fig. 3 from Tse, 2017
eye decreased size, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009
trunk necrotic, abnormal	AB + MO1-cyld2	standard conditions	Fig. S4 from Tse et al., 2009

Citations