Morpholino

MO1-taf3

ID

ZDB-MRPHLNO-091207-3

Name

MO1-taf3

Previous Names

None

Target

Sequence

5' - GCGCGAAGCTCTCACACATCTCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-taf3

Expressed Gene	Anatomy	Figures
gapdh	whole organism	Fig. 2 from Hart et al., 2009
gata1a	blood island intermediate cell mass of mesoderm (not) posterior lateral mesoderm	Fig. 1 , Fig. 2 from Hart et al., 2009
hbbe1.1	blood island (not) intermediate cell mass of mesoderm	Fig. 1 , Fig. 2 from Hart et al., 2009
mespaa	whole organism	Fig. 2 from Hart et al., 2009
pax2a	posterior lateral mesoderm	Fig. 1 from Hart et al., 2009
tal1	intermediate cell mass of mesoderm	Fig. 1 from Hart et al., 2009

Phenotype

Phenotype resulting from MO1-taf3

Phenotype	Fish	Figures
blood island erythroid lineage cell decreased amount, abnormal	sd2Tg + MO1-taf3	Fig. 1 from Hart et al., 2009
embryo development decreased rate, abnormal	WT + MO1-taf3	Fig. 1 from Hart et al., 2009
hemopoiesis disrupted, abnormal	sd2Tg + MO1-taf3	Fig. 1 from Hart et al., 2009
intermediate cell mass of mesoderm erythroid lineage cell decreased amount, abnormal	WT + MO1-taf3	Fig. 2 from Hart et al., 2009
lateral plate mesoderm erythroid progenitor cell decreased amount, abnormal	sd2Tg + MO1-taf3	Fig. 1 from Hart et al., 2009
nucleate erythrocyte absent, abnormal	sd2Tg + MO1-taf3	Fig. 1 from Hart et al., 2009
post-vent region deformed, abnormal	WT + MO1-taf3	Fig. 1 from Hart et al., 2009
somite shape, abnormal	WT + MO1-taf3	Fig. 7 from Stijf-Bultsma et al., 2015
somite skeletal muscle myofibril disorganized, abnormal	WT + MO1-taf3	Fig. 7 from Stijf-Bultsma et al., 2015
somite border morphology, abnormal	WT + MO1-taf3	Fig. 7 from Stijf-Bultsma et al., 2015
trunk curvature, abnormal	sd2Tg + MO1-taf3	Fig. 1 from Hart et al., 2009

Phenotype of all Fish created by or utilizing MO1-taf3

Phenotype	Fish	Conditions	Figures
post-vent region deformed, abnormal	WT + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
intermediate cell mass of mesoderm erythroid lineage cell decreased amount, abnormal	WT + MO1-taf3	standard conditions	Fig. 2 from Hart et al., 2009
somite skeletal muscle myofibril disorganized, abnormal	WT + MO1-taf3	standard conditions	Fig. 7 from Stijf-Bultsma et al., 2015
somite shape, abnormal	WT + MO1-taf3	standard conditions	Fig. 7 from Stijf-Bultsma et al., 2015
embryo development decreased rate, abnormal	WT + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
somite border morphology, abnormal	WT + MO1-taf3	standard conditions	Fig. 7 from Stijf-Bultsma et al., 2015
nucleate erythrocyte absent, abnormal	sd2Tg + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
trunk curvature, abnormal	sd2Tg + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
blood island erythroid lineage cell decreased amount, abnormal	sd2Tg + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
lateral plate mesoderm erythroid progenitor cell decreased amount, abnormal	sd2Tg + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009
hemopoiesis disrupted, abnormal	sd2Tg + MO1-taf3	standard conditions	Fig. 1 from Hart et al., 2009

Citations