Morpholino

MO1-rargb

ID
ZDB-MRPHLNO-090825-4
Name
MO1-rargb
Previous Names
None
Target
Sequence
5' - CGTCTCTCATACCAAGTGGGCTGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rargb
Expressed Gene Anatomy Figures
egr2b Fig. 2 with image from Linville et al., 2009
fabp10a Fig. 3 with image from Garnaas et al., 2012
foxa3 Fig. 4 with image from Garnaas et al., 2012
hand2 Fig. 4 with image from Garnaas et al., 2012
hoxb5a Fig. 2 with image from Linville et al., 2009
mafba Fig. 2 with image from Linville et al., 2009
myh6 Fig. 5 with image from Garnaas et al., 2012
myh7 Fig. 5 with image from Garnaas et al., 2012
myl7 Fig. 5 with image from Garnaas et al., 2012
prox1a Fig. 4 with image from Garnaas et al., 2012
shha Fig. 4 with image from Garnaas et al., 2012
tlx1 Fig. 7 with image from Garnaas et al., 2012
Phenotype
Phenotype resulting from MO1-rargb
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal pt510Tg + MO1-rargb Fig. 5 with image,  Fig. 6 with image from Garnaas et al., 2012
determination of intestine left/right asymmetry disrupted, abnormal WT + MO1-rargb Fig. 4 with image from Garnaas et al., 2012
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-rargb Fig. 4 with image from Garnaas et al., 2012
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-rargb Fig. 4 with image from Garnaas et al., 2012
hepatocyte increased amount, abnormal zf235Tg + MO1-rargb Fig. 3 with image from Garnaas et al., 2012
intrahepatic bile duct decreased branchiness, abnormal um14Tg + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct morphology, abnormal um14Tg + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct cell body increased size, abnormal um14Tg + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct development disrupted, abnormal um14Tg + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
liver bilateral, abnormal WT + MO1-rargb Fig. 3 with image from Garnaas et al., 2012
presumptive cardiac ventricle heart tube mislocalised, abnormal WT + MO1-rargb Fig. 5 with image from Garnaas et al., 2012
spleen agenesis, abnormal WT + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
spleen decreased size, abnormal WT + MO1-rargb Fig. 7 with image from Garnaas et al., 2012
Phenotype of all Fish created by or utilizing MO1-rargb
Phenotype Fish Conditions Figures
presumptive cardiac ventricle heart tube mislocalised, abnormal WT + MO1-rargb standard conditions Fig. 5 with image from Garnaas et al., 2012
spleen agenesis, abnormal WT + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
determination of liver left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 5 with image from Garnaas et al., 2012
determination of intestine left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
liver bilateral, abnormal WT + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
spleen decreased size, abnormal WT + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-rargb standard conditions Fig. 4 with image from Garnaas et al., 2012
determination of heart left/right asymmetry disrupted, abnormal pt510Tg + MO1-rargb standard conditions Fig. 6 with image from Garnaas et al., 2012
intrahepatic bile duct cell body increased size, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct decreased branchiness, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct development disrupted, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
intrahepatic bile duct morphology, abnormal um14Tg + MO1-rargb standard conditions Fig. 7 with image from Garnaas et al., 2012
hepatocyte increased amount, abnormal zf235Tg + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
pharyngeal arch 5 immature, abnormal WT + MO1-rarga + MO1-rargb + MO1-tp53 standard conditions Fig. 4 with image from Linville et al., 2009
liver absent, abnormal WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
liver decreased size, abnormal WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
hepatocyte decreased amount, abnormal zf235Tg + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb standard conditions Fig. 3 with image from Garnaas et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.