Morpholino

MO2-lin9

ID
ZDB-MRPHLNO-090817-2
Name
MO2-lin9
Previous Names
None
Target
Sequence
5' - GTTAGTTTTATTACTCACTCTCGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the exon1-intron1 boundary.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lin9
Expressed Gene Anatomy Figures
aspm Fig. 7 from Kleinschmidt et al., 2009
ccnb1 Fig. 6 from Kleinschmidt et al., 2009
lin9 Fig. 2 from Kleinschmidt et al., 2009
oip5 Fig. 7 from Kleinschmidt et al., 2009
pif1 Fig. 7 from Kleinschmidt et al., 2009
top2a Fig. 7 from Kleinschmidt et al., 2009
Phenotype
Phenotype resulting from MO2-lin9
Phenotype Fish Figures
brain apoptotic, abnormal AB/TU + MO2-lin9 Fig. 4 from Kleinschmidt et al., 2009
brain nucleus apoptotic, abnormal AB/TU + MO2-lin9 Fig. 5 from Kleinschmidt et al., 2009
cell death increased occurrence, abnormal AB/TU + MO2-lin9 Fig. 3,  Fig. 6 from Kleinschmidt et al., 2009
eye decreased size, abnormal AB/TU + MO2-lin9 Fig. 2 from Kleinschmidt et al., 2009
head decreased size, abnormal AB/TU + MO2-lin9 Fig. 2 from Kleinschmidt et al., 2009
mitotic cell cycle increased occurrence, abnormal AB/TU + MO2-lin9 Fig. 5 from Kleinschmidt et al., 2009
olfactory system apoptotic, abnormal AB/TU + MO2-lin9 Fig. 4 from Kleinschmidt et al., 2009
pericardium edematous, abnormal AB/TU + MO2-lin9 Fig. 2 from Kleinschmidt et al., 2009
regulation of cell cycle disrupted, abnormal AB/TU + MO2-lin9 Fig. 3,  Fig. 6 from Kleinschmidt et al., 2009
trunk curved dorsal, abnormal AB/TU + MO2-lin9 Fig. 2 from Kleinschmidt et al., 2009
Phenotype of all Fish created by or utilizing MO2-lin9
Phenotype Fish Conditions Figures
olfactory system apoptotic, abnormal AB/TU + MO2-lin9 standard conditions Fig. 4 from Kleinschmidt et al., 2009
regulation of cell cycle disrupted, abnormal AB/TU + MO2-lin9 standard conditions Fig. 3,  Fig. 6 from Kleinschmidt et al., 2009
cell death increased occurrence, abnormal AB/TU + MO2-lin9 standard conditions Fig. 3,  Fig. 6 from Kleinschmidt et al., 2009
brain apoptotic, abnormal AB/TU + MO2-lin9 standard conditions Fig. 4 from Kleinschmidt et al., 2009
mitotic cell cycle increased occurrence, abnormal AB/TU + MO2-lin9 standard conditions Fig. 5 from Kleinschmidt et al., 2009
eye decreased size, abnormal AB/TU + MO2-lin9 standard conditions Fig. 2 from Kleinschmidt et al., 2009
pericardium edematous, abnormal AB/TU + MO2-lin9 standard conditions Fig. 2 from Kleinschmidt et al., 2009
brain nucleus apoptotic, abnormal AB/TU + MO2-lin9 standard conditions Fig. 5 from Kleinschmidt et al., 2009
head decreased size, abnormal AB/TU + MO2-lin9 standard conditions Fig. 2 from Kleinschmidt et al., 2009
trunk curved dorsal, abnormal AB/TU + MO2-lin9 standard conditions Fig. 2 from Kleinschmidt et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.