Morpholino

MO1-cdh7a

ID

ZDB-MRPHLNO-090108-3

Name

MO1-cdh7a

Previous Names

Target

Sequence

5' - GCCAACAGCAGTATAGTCATTACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking morpholino

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cdh7a

Expressed Gene	Anatomy	Figures
alcama	central nervous system cerebellum hindbrain retinal ganglion cell layer secondary motor neuron axon spinal cord statoacoustic (VIII) ganglion trigeminal ganglion ventral root	Fig. 3, Fig. 5 from Liu et al., 2008
cdh7a	notochord	Fig. 2 from Liu et al., 2008
dlx2a	diencephalon telencephalon	Fig. 4 from Liu et al., 2008
egr2b	rhombomere 3 rhombomere 5	Fig. 4 from Liu et al., 2008
pax7a	cerebellum hindbrain optic tectum spinal cord	Fig. 4 from Liu et al., 2008
shha	diencephalon floor plate notochord	Fig. 3, Fig. 4 from Liu et al., 2008

Phenotype

Phenotype resulting from MO1-cdh7a

Phenotype	Fish	Figures
notochord morphology, abnormal	WT + MO1-cdh7a	Fig. 2 from Liu et al., 2008
notochord undulate, abnormal	WT + MO1-cdh7a	Fig. 2, Fig. 3, text only from Liu et al., 2008
notochord epithelial cell irregular spatial pattern, abnormal	WT + MO1-cdh7a	Fig. 3 from Liu et al., 2008
notochord epithelial cell variability of size, abnormal	WT + MO1-cdh7a	Fig. 3 from Liu et al., 2008
notochord epithelial cell variant shape, abnormal	WT + MO1-cdh7a	Fig. 3 from Liu et al., 2008
whole organism undulate, abnormal	WT + MO1-cdh7a	Fig. 2, Fig. 3 from Liu et al., 2008

Phenotype of all Fish created by or utilizing MO1-cdh7a

Phenotype	Fish	Conditions	Figures
notochord undulate, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 2, Fig. 3, text only from Liu et al., 2008
notochord epithelial cell variant shape, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 3 from Liu et al., 2008
notochord epithelial cell variability of size, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 3 from Liu et al., 2008
whole organism undulate, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 2, Fig. 3 from Liu et al., 2008
notochord morphology, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 2 from Liu et al., 2008
notochord epithelial cell irregular spatial pattern, abnormal	WT + MO1-cdh7a	standard conditions	Fig. 3 from Liu et al., 2008

Citations