Morpholino

MO2-eya4

ID
ZDB-MRPHLNO-081231-5
Name
MO2-eya4
Previous Names
  • MO10eya4 (1)
Target
Sequence
5' - TAATATGTATACCTGGCATCTGATA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-eya4
No data available
Phenotype
Phenotype resulting from MO2-eya4
Phenotype Fish Figures
inner ear morphogenesis disrupted, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
otic vesicle shape, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
pericardium edematous, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal AB + MO2-eya4 Fig. 5 with image,  Fig. 8 with image from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal AB + MO2-eya4 Fig. 5 with image from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal AB + MO2-eya4 Fig. 5 with image,  Fig. 8 with image from Wang et al., 2008
startle response disrupted, abnormal AB + MO2-eya4 Fig. 8 with image from Wang et al., 2008
Phenotype of all Fish created by or utilizing MO2-eya4
Phenotype Fish Conditions Figures
inner ear morphogenesis disrupted, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
startle response disrupted, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
posterior lateral line neuromast decreased amount, abnormal AB + MO2-eya4 standard conditions Fig. 5 with image,  Fig. 8 with image from Wang et al., 2008
posterior lateral line neuromast development disrupted, abnormal AB + MO2-eya4 standard conditions Fig. 5 with image,  Fig. 8 with image from Wang et al., 2008
otic vesicle shape, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal AB + MO2-eya4 standard conditions Fig. 5 with image from Wang et al., 2008
pillar of the posterior semicircular canal malformed, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
pillar of the lateral semicircular canal malformed, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
pericardium edematous, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
pillar of the anterior semicircular canal malformed, abnormal AB + MO2-eya4 standard conditions Fig. 8 with image from Wang et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.