Morpholino

MO2-hspg2

ID
ZDB-MRPHLNO-080807-2
Name
MO2-hspg2
Previous Names
  • DIII-MO (1)
Target
Sequence
5' - ACGAGTCAACCTGCACAACACACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hspg2
Expressed Gene Anatomy Figures
hspg2 Fig. 3 from Zoeller et al., 2008
Phenotype
Phenotype resulting from MO2-hspg2
Phenotype Fish Figures
myoseptum U-shaped, abnormal WT + MO2-hspg2 Fig. 6 from Zoeller et al., 2008
post-vent region curved ventral, abnormal WT + MO2-hspg2 Fig. 3 from Zoeller et al., 2008
post-vent region kinked, abnormal WT + MO2-hspg2 Fig. 3 from Zoeller et al., 2008
sarcomere organization disrupted, abnormal WT + MO2-hspg2 Fig. 6 from Zoeller et al., 2008
skeletal muscle tissue development disrupted, abnormal WT + MO2-hspg2 Fig. S3 from Zoeller et al., 2008
trunk kinked, abnormal WT + MO2-hspg2 Fig. 3 from Zoeller et al., 2008
trunk musculature refractivity, abnormal WT + MO2-hspg2 Fig. 6 from Zoeller et al., 2008
trunk musculature actin filament bundle disorganized, abnormal WT + MO2-hspg2 Fig. S3 from Zoeller et al., 2008
trunk musculature mitochondrial matrix absent, abnormal WT + MO2-hspg2 Fig. S3 from Zoeller et al., 2008
trunk musculature sarcomere morphology, abnormal WT + MO2-hspg2 Fig. 6 from Zoeller et al., 2008
trunk musculature striated muscle thin filament decreased amount, abnormal WT + MO2-hspg2 Fig. S3 from Zoeller et al., 2008
whole organism decreased length, abnormal WT + MO2-hspg2 Fig. 3 from Zoeller et al., 2008
Phenotype of all Fish created by or utilizing MO2-hspg2
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO2-hspg2 standard conditions Fig. 3 from Zoeller et al., 2008
skeletal muscle tissue development disrupted, abnormal WT + MO2-hspg2 standard conditions Fig. S3 from Zoeller et al., 2008
trunk musculature actin filament bundle disorganized, abnormal WT + MO2-hspg2 standard conditions Fig. S3 from Zoeller et al., 2008
myoseptum U-shaped, abnormal WT + MO2-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
post-vent region curved ventral, abnormal WT + MO2-hspg2 standard conditions Fig. 3 from Zoeller et al., 2008
trunk musculature sarcomere morphology, abnormal WT + MO2-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
trunk musculature refractivity, abnormal WT + MO2-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
trunk kinked, abnormal WT + MO2-hspg2 standard conditions Fig. 3 from Zoeller et al., 2008
sarcomere organization disrupted, abnormal WT + MO2-hspg2 standard conditions Fig. 6 from Zoeller et al., 2008
trunk musculature striated muscle thin filament decreased amount, abnormal WT + MO2-hspg2 standard conditions Fig. S3 from Zoeller et al., 2008
trunk musculature mitochondrial matrix absent, abnormal WT + MO2-hspg2 standard conditions Fig. S3 from Zoeller et al., 2008
post-vent region kinked, abnormal WT + MO2-hspg2 standard conditions Fig. 3 from Zoeller et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.