Morpholino

MO2-zeb2b

ID
ZDB-MRPHLNO-080717-6
Name
MO2-zeb2b
Previous Names
  • sip1b SBMO (1)
Target
Sequence
5' - CTCAGACATTCTCACCGTTTTCCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino corresponding to the exon3/exon4 junction.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zeb2b
Expressed Gene Anatomy Figures
crestin Fig. 3 with image from Delalande et al., 2008
dlx2a Fig. 3 with image from Delalande et al., 2008
egr2b Fig. 3 with image from Delalande et al., 2008
myod1 Fig. 3 with image from Delalande et al., 2008
pax2a Fig. 3 with image from Delalande et al., 2008
phox2bb Fig. 3 with image from Delalande et al., 2008
Phenotype
Phenotype resulting from MO2-zeb2b
Phenotype Fish Figures
brain morphology, abnormal WT + MO2-zeb2b Fig. 2 with image from Delalande et al., 2008
central nervous system development disrupted, abnormal WT + MO2-zeb2b Fig. 2 with image from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-zeb2b Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-zeb2b Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal WT + MO2-zeb2b Fig. 2 with image from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal WT + MO2-zeb2b Fig. 2 with image from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-zeb2b Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
Phenotype of all Fish created by or utilizing MO2-zeb2b
Phenotype Fish Conditions Figures
post-anal tail morphogenesis disrupted, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
central nervous system development disrupted, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
brain morphology, abnormal WT + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
neural crest formation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
somite morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image,  Fig. 3 with image from Delalande et al., 2008
dorsal convergence disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
heart morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
brain morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
central nervous system development disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.