Morpholino
MO1-heg1
- ID
- ZDB-MRPHLNO-080714-5
- Name
- MO1-heg1
- Previous Names
- None
- Target
- Sequence
-
5' - GTAATCGTACTTGCAGCAGGTGACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed against intron 11 donor site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-heg1
Expressed Gene | Anatomy | Figures |
---|---|---|
cdh5 |
Fig. S9
from Kleaveland et al., 2009 |
|
myb |
Fig. 3
from Wang et al., 2011 |
|
rag1 |
|
Fig. 3
from Wang et al., 2011 |
rasip1 |
Fig. 8. ![]() |
|
runx1 |
Fig. 3
from Wang et al., 2011 |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO1-heg1
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-heg1
1 - 5 of 16 Show all
Citations
- Lee, M., Betz, C., Yin, J., Paatero, I., Schellinx, N., Carte, A.N., Wilson, C.W., Ye, W., Affolter, M., Belting, H.G. (2021) Control of dynamic cell behaviors during angiogenesis and anastomosis by Rasip1. Development (Cambridge, England). 148(15):
- Donat, S., Lourenço, M., Paolini, A., Otten, C., Renz, M., Abdelilah-Seyfried, S. (2018) Heg1 and Ccm1/2 proteins control endocardial mechanosensitivity during zebrafish valvulogenesis. eLIFE. 7:e28939
- Wang, L., Zhang, P., Wei, Y., Gao, Y., Patient, R., and Liu, F. (2011) A blood flow-dependent klf2a-NO signalling cascade is required for stabilization of hematopoietic stem cell programming in zebrafish embryos. Blood. 118(15):4102-10
- Kleaveland, B., Zheng, X., Liu, J.J., Blum, Y., Tung, J.J., Zou, Z., Chen, M., Guo, L., Lu, M.M., Zhou, D., Kitajewski, J., Affolter, M., Ginsberg, M.H., and Kahn, M.L. (2009) Regulation of cardiovascular development and integrity by the heart of glass-cerebral cavernous malformation protein pathway. Nature medicine. 15(2):169-176
- Ouyang, X., Shestopalov, I.A., Sinha, S., Zheng, G., Pitt, C.L., Li, W.H., Olson, A.J., and Chen, J.K. (2009) Versatile Synthesis and Rational Design of Caged Morpholinos. Journal of the American Chemical Society. 131(37):13255-13269
- Serluca, F.C. (2008) Development of the proepicardial organ in the zebrafish. Developmental Biology. 315(1):18-27
- Mably, J.D., Mohideen, M.A.P.K., Burns, C.G., Chen, J.-N., and Fishman, M.C. (2003) heart of glass regulates the concentric growth of the heart in zebrafish. Current biology : CB. 13(24):2138-2147
1 - 7 of 7
Show