Morpholino

MO1-heg1

ID

ZDB-MRPHLNO-080714-5

Name

MO1-heg1

Previous Names

None

Target

heg1 (1)

Sequence

5' - GTAATCGTACTTGCAGCAGGTGACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

designed against intron 11 donor site

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-heg1

Expressed Gene	Anatomy	Figures
cdh5	blood vessel endothelial cell cell-cell junction	Fig. S9 from Kleaveland et al., 2009
myb	ventral wall of dorsal aorta	Fig. 3 from Wang et al., 2011
rag1	(not) thymus	Fig. 3 from Wang et al., 2011
rasip1	dorsal longitudinal anastomotic vessel cell-cell junction	Fig. 8. from Lee et al., 2021
runx1	ventral wall of dorsal aorta	Fig. 3 from Wang et al., 2011
tcf21	heart	Fig. 6 from Serluca, 2008
wt1a	heart	Fig. 6 from Serluca, 2008

Phenotype

Phenotype resulting from MO1-heg1

Phenotype	Fish	Figures
blood vasculature obstructed, abnormal	y1Tg + MO1-heg1	Fig. 4 from Kleaveland et al., 2009
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal	s843Tg + MO1-heg1	Fig. 8. from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal	s843Tg + MO1-heg1	Fig. 8. from Lee et al., 2021
heart dilated, abnormal	y1Tg + MO1-heg1	Fig. 4 from Kleaveland et al., 2009
heart edematous, abnormal	y1Tg + MO1-heg1	Fig. 4 from Kleaveland et al., 2009
heart increased size, abnormal	WT + MO1-heg1	Fig. 6 from Serluca, 2008
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	s843Tg + MO1-heg1	Fig. 8. from Lee et al., 2021
intersegmental vessel cell-cell junction ab1-cdh5 labeling mislocalised, abnormal	s843Tg + MO1-heg1	Fig. 8. from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	s843Tg + MO1-heg1	Fig. 8. from Lee et al., 2021
pericardium edematous, abnormal	WT + MO1-heg1	Fig. 6 from Serluca, 2008
thymus decreased size, abnormal	WT + MO1-heg1	Fig. 3 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-heg1	Fig. 3 from Wang et al., 2011
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-heg1	Fig. 3 from Wang et al., 2011

Phenotype of all Fish created by or utilizing MO1-heg1

Phenotype	Fish	Conditions	Figures
heart increased size, abnormal	WT + MO1-heg1	standard conditions	Fig. 6 from Serluca, 2008
thymus decreased size, abnormal	WT + MO1-heg1	standard conditions	Fig. 3 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-heg1	standard conditions	Fig. 3 from Wang et al., 2011
pericardium edematous, abnormal	WT + MO1-heg1	standard conditions	Fig. 6 from Serluca, 2008
trunk hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-heg1	standard conditions	Fig. 3 from Wang et al., 2011
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression mislocalised, abnormal	s843Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel cell-cell junction ab1-cdh5 labeling mislocalised, abnormal	s843Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	s843Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	s843Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
dorsal longitudinal anastomotic vessel cell-cell junction rasip1 expression decreased amount, abnormal	s843Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
heart edematous, abnormal	y1Tg + MO1-heg1	standard conditions	Fig. 4 from Kleaveland et al., 2009
heart dilated, abnormal	y1Tg + MO1-heg1	standard conditions	Fig. 4 from Kleaveland et al., 2009
blood vasculature obstructed, abnormal	y1Tg + MO1-heg1	standard conditions	Fig. 4 from Kleaveland et al., 2009
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal	ncv27Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal	ncv27Tg + MO1-heg1	standard conditions	Fig. 8. from Lee et al., 2021
endocardium EGFP expression decreased amount, abnormal	pbb21Tg; ubs3Tg + MO1-heg1	standard conditions	Fig. 1 from Donat et al., 2018

Citations