Morpholino
MO1-mir141,mir200a
- ID
- ZDB-MRPHLNO-080508-1
- Name
- MO1-mir141,mir200a
- Previous Names
- Targets
- Sequence
-
5' - GCATCGTTACCAGACAGTGTTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir141,mir200a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| dre-mir-429 |
Fig. S4 
from Choi et al., 2008 |
|
| mir141 |
Fig. S4
from Choi et al., 2008 |
|
| mir200a |
Fig. S4
from Choi et al., 2008 |
|
| mir200b |
Fig. S4
from Choi et al., 2008 |
|
| mir200c |
Fig. S4
from Choi et al., 2008 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-mir141,mir200a
No data available
Phenotype of all Fish created by or utilizing MO1-mir141,mir200a
1 - 3 of 3
Citations
- Garaffo, G., Conte, D., Provero, P., Tomaiuolo, D., Luo, Z., Pinciroli, P., Peano, C., D'Atri, I., Gitton, Y., Etzion, T., Gothilf, Y., Gays, D., Santoro, M.M., Merlo, G.R. (2015) The Dlx5 and Foxg1 transcription factors, linked via miRNA-9 and -200, are required for the development of the olfactory and GnRH system. Molecular and cellular neurosciences. 68:103-19
- Vannier, C., Mock, K., Brabletz, T., and Driever, W. (2013) Zeb1 regulates E-cadherin and Epcam expression to control cell behavior in early zebrafish development. The Journal of biological chemistry. 288(26):18643-59
- Choi, P.S., Zakhary, L., Choi, W.Y., Caron, S., Alvarez-Saavedra, E., Miska, E.A., McManus, M., Harfe, B., Giraldez, A.J., Horvitz, R.H., Schier, A.F., and Dulac, C. (2008) Members of the miRNA-200 Family Regulate Olfactory Neurogenesis. Neuron. 57(1):41-55
1 - 3 of 3
Show