Morpholino

MO1-plcb3

ID

ZDB-MRPHLNO-080225-4

Name

MO1-plcb3

Previous Names

None

Target

plcb3 (1)

Sequence

5' - TTGTCGTGGTTACCTTGCAATAGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-plcb3

Expressed Gene	Anatomy	Figures
plcb3	whole organism	Fig. 2 from Walker et al., 2007

Phenotype

Phenotype resulting from MO1-plcb3

Phenotype	Fish	Figures
branchiostegal ray 3 shape, abnormal	AB + MO1-plcb3	Fig. 3 from Walker et al., 2007
cartilage element mislocalised, abnormal	AB + MO1-plcb3	Fig. 3 from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal	AB + MO1-plcb3	Fig. 3 from Walker et al., 2007
opercle shape, abnormal	AB + MO1-plcb3	Fig. 3 from Walker et al., 2007

Phenotype of all Fish created by or utilizing MO1-plcb3

Phenotype	Fish	Conditions	Figures
hyosymplectic cartilage decreased size, abnormal	plcb3^th210/th210 + MO1-plcb3 (AB)	standard conditions	Fig. 3 from Walker et al., 2007
branchiostegal ray 3 shape, abnormal	plcb3^th210/th210 + MO1-plcb3 (AB)	standard conditions	Fig. 3 from Walker et al., 2007
cartilage element mislocalised, abnormal	plcb3^th210/th210 + MO1-plcb3 (AB)	standard conditions	Fig. 3 from Walker et al., 2007
opercle shape, abnormal	plcb3^th210/th210 + MO1-plcb3 (AB)	standard conditions	Fig. 3 from Walker et al., 2007
cartilage element mislocalised, abnormal	AB + MO1-plcb3	standard conditions	Fig. 3 from Walker et al., 2007
opercle shape, abnormal	AB + MO1-plcb3	standard conditions	Fig. 3 from Walker et al., 2007
branchiostegal ray 3 shape, abnormal	AB + MO1-plcb3	standard conditions	Fig. 3 from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal	AB + MO1-plcb3	standard conditions	Fig. 3 from Walker et al., 2007
opercle shape, abnormal	AB + MO1-plcb3 + MO2-plcb3	standard conditions	text only from Walker et al., 2007
cartilage element mislocalised, abnormal	AB + MO1-plcb3 + MO2-plcb3	standard conditions	text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal	AB + MO1-plcb3 + MO2-plcb3	standard conditions	text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal	AB + MO1-plcb3 + MO2-plcb3	standard conditions	text only from Walker et al., 2007
cartilage element mislocalised, abnormal	edn1^tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
opercle shape, abnormal	edn1^tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal	edn1^tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal	edn1^tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
cartilage element mislocalised, abnormal	edn1^tf216b/+; plcb3^th210/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal	edn1^tf216b/+; plcb3^th210/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
opercle shape, abnormal	edn1^tf216b/+; plcb3^th210/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal	edn1^tf216b/+; plcb3^th210/+ + MO1-plcb3 + MO2-plcb3 (AB)	standard conditions	text only from Walker et al., 2007

Citations