Morpholino

MO1-meis3

ID
ZDB-MRPHLNO-080117-1
Name
MO1-meis3
Previous Names
  • tMO1 (1)
Target
Sequence
5' - ATCCATGCGATACGGAAGCCGAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker: complementary to position - 19 to 6, where 1 indicates the first nucleotide of the AUG codon
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-meis3
Expressed Gene Anatomy Figures
crestin Fig. 2 from Uribe et al., 2015
ins Fig. 5 with image from diIorio et al., 2007
phox2bb Fig. 3 from Uribe et al., 2015
ptch2 Fig. 7 from Uribe et al., 2015
shha Fig. 7 from Uribe et al., 2015
Phenotype
Phenotype resulting from MO1-meis3
Phenotype Fish Figures
endocrine pancreas mislocalised anteriorly, abnormal WT + MO1-meis3 Fig. 5 with image from diIorio et al., 2007
endoderm shha expression absent, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
enteric nervous system neural crest cell decreased amount, abnormal ba2Tg + MO1-meis3 Fig. 6 from Uribe et al., 2015
fin bud shha expression absent, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
fin bud ptch2 expression decreased amount, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
gut anatomical region has fewer parts of type neural crest cell, abnormal ba2Tg + MO1-meis3 Fig. 6 from Uribe et al., 2015
gut enteric neuron decreased amount, abnormal AB + MO1-meis3 Fig. 5 from Uribe et al., 2015
gut endothelial cell shha expression absent, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
intestinal bulb anatomical region ptch2 expression increased distribution, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
intestinal bulb anatomical region lacks all parts of type neural crest cell, abnormal ba2Tg + MO1-meis3 Fig. 2 from Uribe et al., 2015
intestinal bulb enteric neuron decreased amount, abnormal AB + MO1-meis3 Fig. 5 from Uribe et al., 2015
intestinal bulb left side phox2bb expression mislocalised, abnormal AB + MO1-meis3 Fig. 3 from Uribe et al., 2015
intestinal bulb right side phox2bb expression mislocalised, abnormal AB + MO1-meis3 Fig. 3 from Uribe et al., 2015
intestinal bulb primordium ptch2 expression decreased amount, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
intestinal bulb primordium anatomical region EGFP expression absent, abnormal ba2Tg + MO1-meis3 Fig. 2 from Uribe et al., 2015
mesenchyme ptch2 expression increased distribution, abnormal AB + MO1-meis3 Fig. 7 from Uribe et al., 2015
mid intestine enteric neuron decreased amount, abnormal AB + MO1-meis3 Fig. 5 from Uribe et al., 2015
mid intestine left side phox2bb expression absent, abnormal AB + MO1-meis3 Fig. 3 from Uribe et al., 2015
mid intestine right side phox2bb expression absent, abnormal AB + MO1-meis3 Fig. 3 from Uribe et al., 2015
neural crest cell cell population proliferation decreased process quality, abnormal ba2Tg + MO1-meis3 Fig. 6 from Uribe et al., 2015
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal s870Tg; vu234Tg + MO1-meis3 Fig. 2,  Fig. 3,  Fig. 4 from Uribe et al., 2015
neural crest cell migration involved in autonomic nervous system development decreased rate, abnormal s870Tg; vu234Tg + MO1-meis3 Fig. 4 from Uribe et al., 2015
posterior intestine enteric neuron absent, abnormal AB + MO1-meis3 Fig. 5 from Uribe et al., 2015
vagal ganglion anatomical region phox2bb expression mislocalised, abnormal AB + MO1-meis3 Fig. 3 from Uribe et al., 2015
Phenotype of all Fish created by or utilizing MO1-meis3
Phenotype Fish Conditions Figures
vagal ganglion anatomical region phox2bb expression mislocalised, abnormal AB + MO1-meis3 control Fig. 3 from Uribe et al., 2015
intestinal bulb primordium ptch2 expression decreased amount, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
intestinal bulb left side phox2bb expression mislocalised, abnormal AB + MO1-meis3 control Fig. 3 from Uribe et al., 2015
mid intestine left side phox2bb expression absent, abnormal AB + MO1-meis3 control Fig. 3 from Uribe et al., 2015
endoderm shha expression absent, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
fin bud ptch2 expression decreased amount, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
gut enteric neuron decreased amount, abnormal AB + MO1-meis3 control Fig. 5 from Uribe et al., 2015
mid intestine right side phox2bb expression absent, abnormal AB + MO1-meis3 control Fig. 3 from Uribe et al., 2015
posterior intestine enteric neuron absent, abnormal AB + MO1-meis3 control Fig. 5 from Uribe et al., 2015
intestinal bulb anatomical region ptch2 expression position, ameliorated AB + MO1-meis3 chemical treatment: Cyclopamine Fig. 7 from Uribe et al., 2015
gut endothelial cell shha expression absent, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal AB + MO1-meis3 control Fig. 2,  Fig. 3 from Uribe et al., 2015
fin bud shha expression absent, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
intestinal bulb anatomical region ptch2 expression increased distribution, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
mid intestine enteric neuron decreased amount, abnormal AB + MO1-meis3 control Fig. 5 from Uribe et al., 2015
mesenchyme ptch2 expression increased distribution, abnormal AB + MO1-meis3 control Fig. 7 from Uribe et al., 2015
intestinal bulb enteric neuron decreased amount, abnormal AB + MO1-meis3 control Fig. 5 from Uribe et al., 2015
intestinal bulb right side phox2bb expression mislocalised, abnormal AB + MO1-meis3 control Fig. 3 from Uribe et al., 2015
endocrine pancreas mislocalised anteriorly, abnormal WT + MO1-meis3 standard conditions Fig. 5 with image from diIorio et al., 2007
endocrine pancreas mislocalised anteriorly, abnormal WT + MO1-meis3 chemical treatment: pharmaceutical Fig. 2 with image,  Fig. 5 with image from diIorio et al., 2007
enteric nervous system neural crest cell decreased amount, abnormal ba2Tg + MO1-meis3 control Fig. 6 from Uribe et al., 2015
gut anatomical region has fewer parts of type neural crest cell, abnormal ba2Tg + MO1-meis3 control Fig. 6 from Uribe et al., 2015
intestinal bulb primordium anatomical region EGFP expression absent, abnormal ba2Tg + MO1-meis3 control Fig. 2 from Uribe et al., 2015
intestinal bulb anatomical region lacks all parts of type neural crest cell, abnormal ba2Tg + MO1-meis3 control Fig. 2 from Uribe et al., 2015
neural crest cell cell population proliferation decreased process quality, abnormal ba2Tg + MO1-meis3 control Fig. 6 from Uribe et al., 2015
neural crest cell migration involved in autonomic nervous system development decreased rate, abnormal s870Tg; vu234Tg + MO1-meis3 control Fig. 4 from Uribe et al., 2015
neural crest cell migration involved in autonomic nervous system development decreased process quality, abnormal s870Tg; vu234Tg + MO1-meis3 control Fig. 4 from Uribe et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.