Morpholino

MO1-pafah1b1b

ID
ZDB-MRPHLNO-071201-1
Name
MO1-pafah1b1b
Previous Names
  • lis1a-ATG (1)
Target
Sequence
5' - CTCGTTGCCTCTGTGACAGCACCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pafah1b1b
No data available
Phenotype
Phenotype resulting from MO1-pafah1b1b
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
brain cell necrotic, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
circulatory system process disrupted, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
eye decreased size, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
heart swollen, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
heart contraction delayed, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
notochord malformed, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
optic vesicle malformed, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
pigment cell morphology, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
posterior intestine morphology, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
tail bud decreased size, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
trunk musculature disorganized, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
whole organism curved ventral, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
whole organism lethal (sensu genetics), abnormal WT + MO1-pafah1b1b text only from Sun et al., 2009
whole organism movement quality, abnormal WT + MO1-pafah1b1b Fig. 6 from Sun et al., 2009
Phenotype of all Fish created by or utilizing MO1-pafah1b1b
Phenotype Fish Conditions Figures
apical protein localization disrupted, abnormal AB + MO1-pafah1b1b + MO2-pafah1b1b standard conditions Fig. 9 with image from Tsujikawa et al., 2007
whole organism lethal (sensu genetics), abnormal WT + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
heart contraction delayed, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
whole organism movement quality, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
pigment cell morphology, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
posterior intestine morphology, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
heart swollen, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
trunk musculature disorganized, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
circulatory system process disrupted, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
brain decreased size, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
notochord malformed, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
tail bud decreased size, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
eye decreased size, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
brain cell necrotic, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
whole organism curved ventral, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
optic vesicle malformed, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO1-pafah1b1b standard conditions Fig. 6 from Sun et al., 2009
pigment cell morphology, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
whole organism curved ventral, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
brain decreased size, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
circulatory system process disrupted, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
whole organism lethal (sensu genetics), abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
brain morphology, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
eye decreased size, abnormal WT + MO1-pafah1b1a + MO1-pafah1b1b standard conditions text only from Sun et al., 2009
eye decreased size, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
brain morphology, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
whole organism curved ventral, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
brain decreased size, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
pigment cell morphology, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
circulatory system process disrupted, abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
whole organism lethal (sensu genetics), abnormal WT + MO1-pafah1b1b + MO2-pafah1b1a standard conditions text only from Sun et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.