Morpholino
MO1-raf1a
- ID
- ZDB-MRPHLNO-070904-8
- Name
- MO1-raf1a
- Previous Names
-
- MO1-raf1
- Target
- Sequence
-
5' - TGCTCCCTGAAGCTGCTCCATTACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-raf1a
Expressed Gene | Anatomy | Figures |
---|---|---|
cmlc1 |
Fig. 3
from Razzaque et al., 2007 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-raf1a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-raf1a
1 - 5 of 7 Show all
Citations
- Liu, X., Xiong, C., Jia, S., Zhang, Y., Chen, Y.G., Wang, Q., and Meng, A. (2013) Araf kinase antagonizes Nodal-Smad2 activity in mesendoderm development by directly phosphorylating the Smad2 linker region. Nature communications. 4:1728
- Razzaque, M.A., Nishizawa, T., Komoike, Y., Yagi, H., Furutani, M., Amo, R., Kamisago, M., Momma, K., Katayama, H., Nakagawa, M., Fujiwara, Y., Matsushima, M., Mizuno, K., Tokuyama, M., Hirota, H., Muneuchi, J., Higashinakagawa, T., and Matsuoka, R. (2007) Germline gain-of-function mutations in RAF1 cause Noonan syndrome. Nature Genetics. 39(8):1013-1017
1 - 2 of 2
Show