Morpholino

MO2-ednraa

ID

ZDB-MRPHLNO-070829-2

Name

MO2-ednraa

Previous Names

Target

Sequence

5' - ATCAGACTTTTCTTTACCTGCTTAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targets 6th, transmembrane domain; splice blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ednraa

Expressed Gene	Anatomy	Figures
dlx2a	pharyngeal arch	Fig. 4 from Nair et al., 2007
en2a	mandibular muscle	Fig. 4 from Nair et al., 2007
gsc	dorsal hyoid arch palatoquadrate arch ventral hyoid arch	Fig. 4 from Nair et al., 2007
hand2	pharyngeal arch	Fig. 4 from Nair et al., 2007

Phenotype

Phenotype resulting from MO2-ednraa

Phenotype	Fish	Figures
iridophore mislocalised, abnormal	WT + MO2-ednraa	Fig. 3 from Camargo-Sosa et al., 2019
melanocyte mislocalised, abnormal	WT + MO2-ednraa	Fig. 3 from Camargo-Sosa et al., 2019
trunk ventral region has extra parts of type iridophore, abnormal	WT + MO2-ednraa	Fig. 3 from Camargo-Sosa et al., 2019
trunk ventral region has extra parts of type melanocyte, abnormal	WT + MO2-ednraa	Fig. 3 from Camargo-Sosa et al., 2019

Phenotype of all Fish created by or utilizing MO2-ednraa

Phenotype	Fish	Conditions	Figures
trunk ventral region has extra parts of type melanocyte, abnormal	WT + MO2-ednraa	standard conditions	Fig. 3 from Camargo-Sosa et al., 2019
trunk ventral region has extra parts of type iridophore, abnormal	WT + MO2-ednraa	standard conditions	Fig. 3 from Camargo-Sosa et al., 2019
iridophore mislocalised, abnormal	WT + MO2-ednraa	standard conditions	Fig. 3 from Camargo-Sosa et al., 2019
melanocyte mislocalised, abnormal	WT + MO2-ednraa	standard conditions	Fig. 3 from Camargo-Sosa et al., 2019
mandibular arch skeleton cartilage development disrupted, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 5, Fig. S8 from Gordon et al., 2015
ceratohyal cartilage aplastic, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 3 from Nair et al., 2007
Meckel's cartilage absent, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 5 from Gordon et al., 2015
ventral mandibular arch aplastic, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 3 from Nair et al., 2007
Meckel's cartilage decreased length, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 5, Fig. S8 from Gordon et al., 2015
ceratohyal cartilage hypoplastic, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. S8 from Gordon et al., 2015
Meckel's cartilage decreased size, abnormal	WT + MO1-ednrab + MO2-ednraa	standard conditions	Fig. 3 from Nair et al., 2007

Citations