Morpholino

MO6-notch3

ID
ZDB-MRPHLNO-070614-5
Name
MO6-notch3
Previous Names
None
Target
Sequence
5' - AAGGATCAGTCATCTTACCTTCGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-notch3
Expressed Gene Anatomy Figures
dlc Fig. 2 from Kim et al., 2014
efnb2a Fig. 2 from Kim et al., 2014
foxc1b Fig. 2,  Fig. 6,  Fig. S2 from Kim et al., 2014
her9 Fig. 5 with image from Ma et al., 2007
kdrl Fig. 2 from Kim et al., 2014
myb Fig. 1 from Kim et al., 2014
myod1 Fig. 2 from Kim et al., 2014
runx1 Fig. 1,  Fig. 3,  Fig. 5,  Fig. 6 from Kim et al., 2014
twist1a Fig. S2 from Kim et al., 2014
twist1b Fig. 2,  Fig. 6,  Fig. S2 from Kim et al., 2014
Phenotype
Phenotype resulting from MO6-notch3
Phenotype Fish Figures
dorsal telencephalon radial glial cell proliferative, abnormal AB + MO6-notch3 Fig. 5 with image from Alunni et al., 2013
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch3 Fig. 1,  Fig. 6 from Kim et al., 2014
hematopoietic stem cell differentiation process quality, abnormal AB + MO6-notch3 Fig. 1 from Kim et al., 2014
hemopoiesis process quality, abnormal AB + MO6-notch3 Fig. 1 from Kim et al., 2014
radial glial cell division in pallium increased occurrence, abnormal AB + MO6-notch3 Fig. 5 with image from Alunni et al., 2013
sclerotome development process quality, abnormal WT + MO6-notch3 Fig. 2,  Fig. 6,  Fig. S2 from Kim et al., 2014
thymus development process quality, abnormal zdf8Tg + MO6-notch3 Fig. 1 from Kim et al., 2014
Phenotype of all Fish created by or utilizing MO6-notch3
Phenotype Fish Conditions Figures
dorsal telencephalon radial glial cell proliferative, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic stem cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
radial glial cell division in pallium increased occurrence, abnormal AB + MO6-notch3 standard conditions Fig. 5 with image from Alunni et al., 2013
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1,  Fig. 6 from Kim et al., 2014
hemopoiesis process quality, abnormal AB + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO6-notch3 standard conditions Fig. 2,  Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal WT + MO6-notch3 standard conditions Fig. S2 from Kim et al., 2014
thymus development process quality, abnormal zdf8Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
sclerotome development process quality, abnormal dlctit446/+ + MO6-notch3 (AB) standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal dlctit446/+ + MO6-notch3 (AB) standard conditions Fig. 6 from Kim et al., 2014
sclerotome development process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO2-dld + MO6-notch3 standard conditions Fig. 6 from Kim et al., 2014
dorsal aorta development process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal AB + MO6-notch1b + MO6-notch3 standard conditions Fig. S5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal bw9Tg; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal hzm7Et; kca3Tg + MO6-notch3 standard conditions Fig. 5 from Kim et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal kca3Tg; kca4Tg + MO6-notch3 standard conditions Fig. 3 from Kim et al., 2014
hemopoiesis process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic stem cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
hematopoietic progenitor cell differentiation process quality, abnormal la4Tg; zf169Tg + MO6-notch3 standard conditions Fig. 1 from Kim et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.