Morpholino
MO1-osr2
- ID
- ZDB-MRPHLNO-070321-4
- Name
- MO1-osr2
- Previous Names
- None
- Target
- Sequence
-
5' - AGAGTCTTACTGCCCATTCCCGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
start site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-osr2
Expressed Gene | Anatomy | Figures |
---|---|---|
aldh1a2 |
Fig. 8 ![]() |
|
lhx1a |
Fig. 4
from Tena et al., 2007 |
|
pax2a |
Fig. 3 ![]() Fig. 4 from Tena et al., 2007 |
|
tbx5a |
Fig. 3 ![]() |
|
wnt2ba |
Fig. 6 ![]() |
1 - 5 of 6 Show all
Phenotype
Phenotype resulting from MO1-osr2
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-osr2
1 - 5 of 8 Show all
Citations
- Neto, A., Mercader, N., and Gómez-Skarmeta, J.L. (2012) The osr1 and osr2 genes act in the pronephric anlage downstream of retinoic acid signaling and upstream of wnt2b to maintain pectoral fin development. Development (Cambridge, England). 139(2):301-11
- Tena, J.J., Neto, A., de la Calle-Mustienes, E., Bras-Pereira, C., Casares, F., and Gomez-Skarmeta, J.L. (2007) Odd-skipped genes encode repressors that control kidney development. Developmental Biology. 301(2):518-531
1 - 2 of 2
Show