Morpholino

MO3-jag1b

ID
ZDB-MRPHLNO-070206-6
Name
MO3-jag1b
Previous Names
None
Target
Sequence
5' - AATCCTGCTACTCACTTTCACTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-jag1b
Phenotype
Phenotype resulting from MO3-jag1b
Phenotype Fish Figures
ceratohyal cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
endocrine system has fewer parts of type thyroid follicle, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
gall bladder decreased size, abnormal AB + MO3-jag1b FIGURE 4 with imageFIGURE 5 with image from Bai et al., 2023
gall bladder cell decreased size, abnormal AB + MO3-jag1b FIGURE 5 with image from Bai et al., 2023
hyosymplectic cartilage malformed, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
intrahepatic bile duct decreased amount, abnormal AB + MO3-jag1b FIGURE 5 with image from Bai et al., 2023
intrahepatic bile duct sparse, abnormal AB + MO3-jag1b FIGURE 5 with image from Bai et al., 2023
liver and biliary system decreased functionality, abnormal AB + MO3-jag1b FIGURE 4 with image from Bai et al., 2023
Meckel's cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO3-jag1b Fig. S5 from Porazzi et al., 2012
pericardium edematous, abnormal AB + MO3-jag1b FIGURE 3 with image from Bai et al., 2023
post-vent region increased curvature, abnormal AB + MO3-jag1b FIGURE 3 with image from Bai et al., 2023
thyroid gland development decreased process quality, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
thyroid primordium malformed, abnormal WT + MO3-jag1b Fig. 7 from Porazzi et al., 2012
vertebral column increased curvature, abnormal AB + MO3-jag1b FIGURE 3 with image from Bai et al., 2023
whole organism decreased length, abnormal AB + MO3-jag1b FIGURE 3 with image from Bai et al., 2023
Phenotype of all Fish created by or utilizing MO3-jag1b
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO3-jag1b standard conditions FIGURE 3 with image from Bai et al., 2023
liver and biliary system decreased functionality, abnormal AB + MO3-jag1b standard conditions FIGURE 4 with image from Bai et al., 2023
intrahepatic bile duct sparse, abnormal AB + MO3-jag1b standard conditions FIGURE 5 with image from Bai et al., 2023
gall bladder decreased size, abnormal AB + MO3-jag1b standard conditions FIGURE 4 with imageFIGURE 5 with image from Bai et al., 2023
vertebral column increased curvature, abnormal AB + MO3-jag1b standard conditions FIGURE 3 with image from Bai et al., 2023
pericardium edematous, abnormal AB + MO3-jag1b standard conditions FIGURE 3 with image from Bai et al., 2023
intrahepatic bile duct decreased amount, abnormal AB + MO3-jag1b standard conditions FIGURE 5 with image from Bai et al., 2023
post-vent region increased curvature, abnormal AB + MO3-jag1b standard conditions FIGURE 3 with image from Bai et al., 2023
gall bladder cell decreased size, abnormal AB + MO3-jag1b standard conditions FIGURE 5 with image from Bai et al., 2023
thyroid primordium malformed, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
endocrine system has fewer parts of type thyroid follicle, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
hyosymplectic cartilage malformed, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
thyroid gland development decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. 7 from Porazzi et al., 2012
Meckel's cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
ceratohyal cartilage decreased size, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
embryonic viscerocranium morphogenesis decreased process quality, abnormal WT + MO3-jag1b standard conditions Fig. S5 from Porazzi et al., 2012
pharyngeal endoderm nkx2.4b expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
caudal fin truncated, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
notochord morphology, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism anterior-posterior axis decreased length, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid follicle slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid primordium aplastic/hypoplastic, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
caudal fin kinked, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
thyroid stimulating hormone secreting cell tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
thyroid primordium tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
whole organism tshba expression increased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 3 from de Filippis et al., 2016
thyroid primordium slc5a5 expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2 from de Filippis et al., 2016
thyroid follicle tg expression decreased amount, abnormal AB + MO3-jag1b + MO4-jag1a standard conditions Fig. 2Fig. 3 from de Filippis et al., 2016
Citations