Morpholino
MO1-mttp
- ID
- ZDB-MRPHLNO-070118-2
- Name
- MO1-mttp
- Previous Names
-
- MO1-mtp
- Target
- Sequence
-
5' - CGGCAACCGGCATCATGTTTGGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Sequence shown in Schlegel and Stainier 2006 (Biochemistry 45(51):15179-15187) has been corrected.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mttp
Expressed Gene | Anatomy | Figures |
---|---|---|
fli1 |
Fig. 1
from Avraham-Davidi et al., 2012 |
|
flt1 |
Fig. 3
from Avraham-Davidi et al., 2012 |
|
flt4 |
Fig. 3
from Avraham-Davidi et al., 2012 |
|
kdrl |
Fig. 3
from Avraham-Davidi et al., 2012 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-mttp
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-mttp
1 - 5 of 7 Show all
Citations
- Templehof, H., Moshe, N., Avraham-Davidi, I., Yaniv, K. (2021) Zebrafish mutants provide insights into Apolipoprotein B functions during embryonic development and pathological conditions. JCI insight. 6(13):
- Avraham-Davidi, I., Ely, Y., Pham, V.N., Castranova, D., Grunspan, M., Malkinson, G., Gibbs-Bar, L., Mayseless, O., Allmog, G., Lo, B., Warren, C.M., Chen, T.T., Ungos, J., Kidd, K., Shaw, K., Rogachev, I., Wan, W., Murphy, P.M., Farber, S.A., Carmel, L., Shelness, G.S., Iruela-Arispe, M.L., Weinstein, B.M., and Yaniv, K. (2012) ApoB-containing lipoproteins regulate angiogenesis by modulating expression of VEGF receptor 1. Nature medicine. 18(6):967-973
- Lim, A.H., Suli, A., Yaniv, K., Weinstein, B., Li, D.Y., and Chien, C.B. (2011) Motoneurons are essential for vascular pathfinding. Development (Cambridge, England). 138(17):3847-3857
- Schlegel, A., and Stainier, D.Y. (2006) Microsomal Triglyceride Transfer Protein Is Required for Yolk Lipid Utilization and Absorption of Dietary Lipids in Zebrafish Larvae. Biochemistry. 45(51):15179-15187
1 - 4 of 4
Show