Morpholino
MO1-smarca4a
- ID
- ZDB-MRPHLNO-061215-3
- Name
- MO1-smarca4a
- Previous Names
-
- Brg1MO2 (1)
- MO1-smarca4
- Target
- Sequence
-
5' - CATGGGTGGGTCAGGAGTGGACATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smarca4a
Expressed Gene | Anatomy | Figures |
---|---|---|
ctnnb1 |
Fig. 10 ![]() |
|
egr2b |
Fig. 3 ![]() |
|
en2a |
Fig. 3 ![]() ![]() |
|
foxd3 |
Fig. 6 ![]() |
|
fzd2 |
Fig. 10 ![]() |
1 - 5 of 19 Show all
Phenotype
Phenotype resulting from MO1-smarca4a
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO1-smarca4a
1 - 5 of 12 Show all
Citations
- Liu, G., Wang, W., Hu, S., Wang, X., Zhang, Y. (2018) Inherited DNA methylation primes the establishment of accessible chromatin during genome activation. Genome research. 28(7):998-1007
- Takeuchi, J.K., Lou, X., Alexander, J.M., Sugizaki, H., Delgado-Olguín, P., Holloway, A.K., Mori, A.D., Wylie, J.N., Munson, C., Zhu, Y., Zhou, Y.Q., Yeh, R.F., Henkelman, R.M., Harvey, R.P., Metzger, D., Chambon, P., Stainier, D.Y., Pollard, K.S., Scott, I.C., and Bruneau, B.G. (2011) Chromatin remodelling complex dosage modulates transcription factor function in heart development. Nature communications. 2:187
- Mallappa, C., Nasipak, B.T., Etheridge, L., Androphy, E.J., Jones, S.N., Sagerström, C.G., Ohkawa, Y., and Imbalzano, A.N. (2010) Myogenic microRNA expression requires ATP-dependent chromatin remodeling enzyme function. Molecular and cellular biology. 30(13):3176-3186
- Eroglu, B., Wang, G., Tu, N., Sun, X., and Mivechi, N.F. (2006) Critical role of Brg1 member of the SWI/SNF chromatin remodeling complex during neurogenesis and neural crest induction in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(10):2722-2735
- Gregg, R.G., Willer, G.B., Fadool, J.M., Dowling, J.E., and Link, B.A. (2003) Positional cloning of the young mutation identifies an essential role for the Brahma chromatin remodeling complex in mediating retinal cell differentiation. Proceedings of the National Academy of Sciences of the United States of America. 100(11):6535-6540
1 - 5 of 5
Show