Morpholino
MO1-pax2a
- ID
- ZDB-MRPHLNO-061106-5
- Name
- MO1-pax2a
- Previous Names
-
- pax2a-MO (1)
- Target
- Sequence
-
5' - GGTCTGCTTTGCAGTGAATATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax2a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| six1b |
Fig. 11
from Bricaud et al., 2006 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-pax2a
from 1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-pax2a
1 - 5 of 12 Show all
Citations
- Gou, Y., Vemaraju, S., Sweet, E.M., Kwon, H.J., Riley, B.B. (2018) sox2 and sox3 play unique roles in development of hair cells and neurons in the zebrafish inner ear. Developmental Biology. 435(1):73-83
- Shim, H., Kim, J.H., Kim, C.Y., Hwang, S., Kim, H., Yang, S., Lee, J.E., Lee, I. (2016) Function-driven discovery of disease genes in zebrafish using an integrated genomics big data resource. Nucleic acids research. 44:9611-9623
- Gerlach, G.F., Wingert, R.A. (2014) Zebrafish pronephros tubulogenesis and epithelial identity maintenance are reliant on the polarity proteins Prkc iota and zeta. Developmental Biology. 396(2):183-200
- Wang, Y., Sun, Z.H., Zhou, L., Li, Z., Gui, J.F. (2014) Grouper tshbeta Promoter-Driven Transgenic Zebrafish Marks Proximal Kidney Tubule Development. PLoS One. 9:e97806
- Sweet, E.M., Vemaraju, S., and Riley, B.B. (2011) Sox2 and Fgf interact with Atoh1 to promote sensory competence throughout the zebrafish inner ear. Developmental Biology. 358(1):113-21
- Bricaud, O., and Collazo, A. (2006) The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear. The Journal of neuroscience : the official journal of the Society for Neuroscience. 26(41):10438-10451
1 - 6 of 6
Show