Morpholino

MO1-pax2a

ID

ZDB-MRPHLNO-061106-5

Name

MO1-pax2a

Previous Names

Target

Sequence

5' - GGTCTGCTTTGCAGTGAATATCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pax2a

Expressed Gene	Anatomy	Figures
six1b	otic vesicle	Fig. 11 from Bricaud et al., 2006

Phenotype

Phenotype resulting from MO1-pax2a

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO1-pax2a	Fig. S1 from Shim et al., 2016
cilium assembly disrupted, abnormal	WT + MO1-pax2a	Fig. 5 from Shim et al., 2016
determination of heart left/right asymmetry disrupted, abnormal	s843Tg + MO1-pax2a	Fig. 5 from Shim et al., 2016
heart edematous, abnormal	s843Tg + MO1-pax2a	Fig. 5, Fig. S1 from Shim et al., 2016
otic vesicle neurog1 expression increased amount, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	Fig. 8 from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	Fig. 8 from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	Fig. 8 from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	Fig. 8 from Gou et al., 2018
otolith malformed, abnormal	WT + MO1-pax2a	Fig. S1 from Shim et al., 2016
peripheral olfactory organ cilium morphology, abnormal	WT + MO1-pax2a	Fig. 5 from Shim et al., 2016
post-vent region curved, abnormal	WT + MO1-pax2a	Fig. S1 from Shim et al., 2016

Phenotype of all Fish created by or utilizing MO1-pax2a

Phenotype	Fish	Conditions	Figures
otic vesicle neurog1 expression increased amount, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	heat shock	Fig. 8 from Gou et al., 2018
otic vesicle atoh1a expression increased distribution, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	heat shock	Fig. 8 from Gou et al., 2018
otic vesicle atoh1a expression increased amount, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	heat shock	Fig. 8 from Gou et al., 2018
otic vesicle neurog1 expression increased distribution, abnormal	x21Tg/x21Tg + MO1-pax2a + MO4-tp53 (AB)	heat shock	Fig. 8 from Gou et al., 2018
brain hydrocephalic, abnormal	WT + MO1-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
otolith malformed, abnormal	WT + MO1-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
heart edematous, abnormal	WT + MO1-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
post-vent region curved, abnormal	WT + MO1-pax2a	standard conditions	Fig. S1 from Shim et al., 2016
cilium assembly disrupted, abnormal	WT + MO1-pax2a	standard conditions	Fig. 5 from Shim et al., 2016
peripheral olfactory organ cilium morphology, abnormal	WT + MO1-pax2a	standard conditions	Fig. 5 from Shim et al., 2016
heart edematous, abnormal	s843Tg + MO1-pax2a	standard conditions	Fig. 5 from Shim et al., 2016
determination of heart left/right asymmetry disrupted, abnormal	s843Tg + MO1-pax2a	standard conditions	Fig. 5 from Shim et al., 2016

Citations