Morpholino
MO1-en2b
- ID
- ZDB-MRPHLNO-060930-3
- Name
- MO1-en2b
- Previous Names
-
- eng3-MO (1)
- MO1-eng2b
- Target
- Sequence
-
5' - CTATGATCATTTTCTTCCATAGTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-en2b
No data available
Phenotype
Phenotype resulting from MO1-en2b
No data available
Phenotype of all Fish created by or utilizing MO1-en2b
1 - 5 of 11 Show all
Citations
- Albuixech-Crespo, B., López-Blanch, L., Burguera, D., Maeso, I., Sánchez-Arrones, L., Moreno-Bravo, J.A., Somorjai, I., Pascual-Anaya, J., Puelles, E., Bovolenta, P., Garcia-Fernàndez, J., Puelles, L., Irimia, M., Ferran, J.L. (2017) Molecular regionalization of the developing amphioxus neural tube challenges major partitions of the vertebrate brain. PLoS Biology. 15:e2001573
- Erickson, T., Scholpp, S., Brand, M., Moens, C.B., and Waskiewicz, A. Jan (2007) Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries. Developmental Biology. 301(2):504-517
- Picker, A., Scholpp, S., Bohli, H., Takeda, H., and Brand, M. (2002) A novel positive transcriptional feedback loop in midbrain-hindbrain boundary development is revealed through analysis of the zebrafish pax2.1 promoter in transgenic lines. Development (Cambridge, England). 129(13):3227-3239
- Scholpp, S. and Brand, M. (2001) Morpholino-induced knockdown of zebrafish engrailed genes eng2 and eng3 reveals redundant and unique functions in midbrain–hindbrain boundary development. Genesis (New York, N.Y. : 2000). 30(3):129-133
1 - 4 of 4
Show