Morpholino

MO2-tfap2a

ID
ZDB-MRPHLNO-060927-2
Name
MO2-tfap2a
Previous Names
  • ap2a E3I3 (1)
  • MO5-tfap2a (1)
  • tfap2a1 3.1mo (1)
Target
Sequence
5' - GAAATTGCTTACCTTTTTTGATTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2a
Expressed Gene Anatomy Figures
hand2 Fig. 5 with image from Wendl et al., 2007
Phenotype
Phenotype resulting from MO2-tfap2a
Phenotype Fish Figures
ceratohyal cartilage hypoplastic, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
ceratohyal cartilage medially rotated, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
eye decreased size, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
melanocyte decreased amount, abnormal WT + MO2-tfap2a Fig. 6 with image from Van Otterloo et al., 2010
optic fissure closure incomplete, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
palatoquadrate cartilage disorganized, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
retinal pigmented epithelium mislocalised, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
retinal pigmented epithelium protruding, abnormal WT + MO2-tfap2a Fig. 4 from Gestri et al., 2009
Phenotype of all Fish created by or utilizing MO2-tfap2a
Phenotype Fish Conditions Figures
ceratohyal cartilage hypoplastic, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
ceratohyal cartilage medially rotated, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
retinal pigmented epithelium protruding, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
retinal pigmented epithelium mislocalised, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
melanocyte decreased amount, abnormal WT + MO2-tfap2a standard conditions Fig. 6 with image from Van Otterloo et al., 2010
palatoquadrate cartilage disorganized, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
eye decreased size, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
optic fissure closure incomplete, abnormal WT + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
optic fissure closure incomplete, abnormal bmp4st72/st72 + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
optic fissure closure incomplete, abnormal tcf7l1am881/+ + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
eye aplastic, abnormal tcf7l1am881/m881 + MO2-tfap2a standard conditions Fig. 4 from Gestri et al., 2009
melanocyte decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with image from Van Otterloo et al., 2010
melanocyte differentiation disrupted, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Van Otterloo et al., 2010
melanocyte pigment granule decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with image,  Fig. 8 with image from Van Otterloo et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.