Morpholino

MO1-lamb1a

ID

ZDB-MRPHLNO-060916-1

Name

MO1-lamb1a

Previous Names

MO1-lamb1

Target

lamb1a (1)

Sequence

5' - TATTTCCAGTTTCTTTCTTCAGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lamb1a

No data available

Phenotype

Phenotype resulting from MO1-lamb1a

Phenotype	Fish	Figures
endoderm increased width, abnormal	ha01Tg + MO1-lamb1a + MO4-tp53	Fig. S6 from Hu et al., 2018
fast muscle cell myosin filament disorganized, abnormal	WT + MO1-lamb1a	Fig. S1 from Snow et al., 2008
muscle cell migration disrupted, abnormal	WT + MO1-lamb1a	Fig. S1 from Snow et al., 2008
muscle tissue development disrupted, abnormal	WT + MO1-lamb1a	Fig. 3 from Goody et al., 2010
myotome decreased thickness, abnormal	WT + MO1-lamb1a	Fig. 3 from Goody et al., 2010
myotome shape, abnormal	WT + MO1-lamb1a	Fig. S1 from Snow et al., 2008
myotome U-shaped, abnormal	WT + MO1-lamb1a	Fig. 3 from Goody et al., 2010
notochord undifferentiated, abnormal	WT + MO1-lamb1a	Fig. 3 from Parsons et al., 2002
notochord formation disrupted, abnormal	WT + MO1-lamb1a	Fig. 3 from Parsons et al., 2002
skeletal muscle fiber development disrupted, abnormal	WT + MO1-lamb1a	Fig. S1 from Snow et al., 2008
slow muscle cell myosin filament disorganized, abnormal	WT + MO1-lamb1a	Fig. S1 from Snow et al., 2008
whole organism decreased length, abnormal	WT + MO1-lamb1a	Fig. 3 from Parsons et al., 2002

Phenotype of all Fish created by or utilizing MO1-lamb1a

Phenotype	Fish	Conditions	Figures
myotome U-shaped, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Goody et al., 2010
muscle cell migration disrupted, abnormal	WT + MO1-lamb1a	standard conditions	Fig. S1 from Snow et al., 2008
muscle tissue development disrupted, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Goody et al., 2010
myotome shape, abnormal	WT + MO1-lamb1a	standard conditions	Fig. S1 from Snow et al., 2008
fast muscle cell myosin filament disorganized, abnormal	WT + MO1-lamb1a	standard conditions	Fig. S1 from Snow et al., 2008
myotome decreased thickness, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Goody et al., 2010
skeletal muscle fiber development disrupted, abnormal	WT + MO1-lamb1a	standard conditions	Fig. S1 from Snow et al., 2008
muscle tissue development disrupted, abnormal	WT + MO1-lamb1a	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2010
notochord undifferentiated, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Parsons et al., 2002
myotome U-shaped, abnormal	WT + MO1-lamb1a	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2010
slow muscle cell myosin filament disorganized, abnormal	WT + MO1-lamb1a	standard conditions	Fig. S1 from Snow et al., 2008
whole organism decreased length, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Parsons et al., 2002
notochord formation disrupted, abnormal	WT + MO1-lamb1a	standard conditions	Fig. 3 from Parsons et al., 2002
myotome decreased thickness, abnormal	WT + MO1-lamb1a	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2010
endoderm increased width, abnormal	ha01Tg + MO1-lamb1a + MO4-tp53	standard conditions	Fig. S6 from Hu et al., 2018
endoderm increased width, abnormal	ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53	standard conditions	Fig. 6 , Fig. S6 from Hu et al., 2018
endoderm increased width, ameliorated	gpc4^fr6/fr6; ha01Tg + MO1-fn1a + MO1-lamb1a + MO4-tp53	standard conditions	Fig. 6 from Hu et al., 2018

Citations