Morpholino

MO1-six1b

ID

ZDB-MRPHLNO-060606-5

Name

MO1-six1b

Previous Names

Target

Sequence

5' - CGAAAGAAGGCAACATTGACATGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-six1b

Expressed Gene	Anatomy	Figures
cga	adenohypophysis	Fig. 8 , Fig. S2 from Nica et al., 2006
dlx2a	pharyngeal arch	Fig. 3 from Lin et al., 2009
edn1	mesoderm	Fig. 3 from Lin et al., 2009
fgf3	pharyngeal pouch	Fig. 3 from Lin et al., 2009
gh1	adenohypophyseal placode (not) adenohypophysis	Fig. 8 , Fig. S2 from Nica et al., 2006
myf5	dorsal oblique extraocular muscle (not) hypaxialis (not) pectoral fin musculature pharyngeal arch 2 pharyngeal arch 3 (not) sternohyoid ventral oblique extraocular muscle	Fig. 2 , Fig. 5 from Lin et al., 2009
myod1	dorsal oblique extraocular muscle dorsal rectus (not) hypaxialis lateral rectus (not) pectoral fin musculature ventral oblique extraocular muscle	Fig. 2 , Fig. 5 from Lin et al., 2009
myog	dorsal oblique extraocular muscle dorsal rectus lateral rectus ventral oblique extraocular muscle	Fig. 2 from Lin et al., 2009
pomca	adenohypophysis hypothalamus pars anterior pars intermedia	Fig. 3 from Pogoda et al., 2009 Fig. 8 , Fig. S2 from Nica et al., 2006
prl	adenohypophyseal placode	Fig. 8 from Nica et al., 2006

Phenotype

Phenotype resulting from MO1-six1b

Phenotype	Fish	Figures
medial rectus aplastic, abnormal	twu3Tg + MO1-six1b	Fig. 2 from Lin et al., 2009
pharyngeal arch muscle aplastic, abnormal	twu3Tg + MO1-six1b	Fig. 2 from Lin et al., 2009
sternohyoid aplastic, abnormal	twu3Tg + MO1-six1b	Fig. 2 from Lin et al., 2009
ventral rectus aplastic, abnormal	twu3Tg + MO1-six1b	Fig. 2 from Lin et al., 2009

Phenotype of all Fish created by or utilizing MO1-six1b

Phenotype	Fish	Conditions	Figures
medial rectus aplastic, abnormal	WT + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009
ventral rectus aplastic, abnormal	WT + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009
sternohyoid aplastic, abnormal	twu3Tg + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009
pharyngeal arch muscle aplastic, abnormal	twu3Tg + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009
medial rectus aplastic, abnormal	twu3Tg + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009
ventral rectus aplastic, abnormal	twu3Tg + MO1-six1b	standard conditions	Fig. 2 from Lin et al., 2009

Citations