Morpholino

MO1-foxa3

ID
ZDB-MRPHLNO-060321-4
Name
MO1-foxa3
Previous Names
  • MO-gamma3-FoxA3 (1)
Target
Sequence
5' - CTCGTAAGAAACGGGATAGTGACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxa3
Phenotype
Phenotype resulting from MO1-foxa3
Phenotype of all Fish created by or utilizing MO1-foxa3
Phenotype Fish Conditions Figures
goblet cell cell maturation disrupted, abnormal WT + MO1-foxa3 standard conditions Fig. S9 from Lai et al., 2016
ventral mesenchyme distended, abnormal WT + MO1-foxa3 standard conditions Fig. 2 with image from Seiliez et al., 2006
tail bud morphology, abnormal WT + MO1-foxa3 standard conditions Fig. 2 with image from Seiliez et al., 2006
hatching gland aplastic, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 2 with imageFig. S7 with image from Dal-Pra et al., 2011
anterior axial hypoblast morphology, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
prechordal plate poorly differentiated, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
notochord cell decreased size, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with image from Dal-Pra et al., 2011
hypochord decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S1 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
floor plate disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with imageFig. 8 with image from Dal-Pra et al., 2011
floor plate cell elongated, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. S1 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 3 with image from Dal-Pra et al., 2011
floor plate decreased length, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. S2 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 standard conditions Fig. 1 with imageFig. 8 with imageFig. S2 with image from Dal-Pra et al., 2011
midbrain aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
forebrain aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
midbrain hindbrain boundary aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
eye fused with eye, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with imageFig. 6 with image from Seiliez et al., 2006
head aplastic, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with image from Seiliez et al., 2006
head morphogenesis disrupted, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 2 with imageFig. 6 with image from Seiliez et al., 2006
head truncated, abnormal WT + MO1-foxa3 + MO1-gsc standard conditions Fig. 6 with image from Seiliez et al., 2006
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3 standard conditions Fig. S2 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
head truncated, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
eye fused with eye, abnormal WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a standard conditions Fig. 6 with image from Seiliez et al., 2006
Citations