Morpholino

MO1-foxa3

ID

ZDB-MRPHLNO-060321-4

Name

MO1-foxa3

Previous Names

MO-gamma3-FoxA3 (1)

Target

foxa3 (1)

Sequence

5' - CTCGTAAGAAACGGGATAGTGACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxa3

Expressed Gene	Anatomy	Figures
agr2	intestine goblet cell pharynx	Fig. 5, Fig. S9 from Lai et al., 2016
muc2.1	intestine goblet cell	Fig. S10 from Lai et al., 2016
shha	pharynx	Fig. 5 from Lai et al., 2016

Phenotype

Phenotype resulting from MO1-foxa3

Phenotype	Fish	Figures
goblet cell cell maturation disrupted, abnormal	WT + MO1-foxa3	Fig. S9 from Lai et al., 2016
tail bud morphology, abnormal	WT + MO1-foxa3	Fig. 2 from Seiliez et al., 2006
ventral mesenchyme distended, abnormal	WT + MO1-foxa3	Fig. 2 from Seiliez et al., 2006

Phenotype of all Fish created by or utilizing MO1-foxa3

Phenotype	Fish	Conditions	Figures
goblet cell cell maturation disrupted, abnormal	WT + MO1-foxa3	standard conditions	Fig. S9 from Lai et al., 2016
ventral mesenchyme distended, abnormal	WT + MO1-foxa3	standard conditions	Fig. 2 from Seiliez et al., 2006
tail bud morphology, abnormal	WT + MO1-foxa3	standard conditions	Fig. 2 from Seiliez et al., 2006
hatching gland aplastic, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 2 , Fig. S7 from Dal-Pra et al., 2011
anterior axial hypoblast morphology, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
prechordal plate poorly differentiated, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 from Dal-Pra et al., 2011
notochord cell decreased size, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
hypochord decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S1 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
floor plate disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
floor plate cell elongated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
floor plate decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
midbrain aplastic, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 from Seiliez et al., 2006
forebrain aplastic, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 from Seiliez et al., 2006
midbrain hindbrain boundary aplastic, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 from Seiliez et al., 2006
eye fused with eye, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 , Fig. 6 from Seiliez et al., 2006
head aplastic, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 from Seiliez et al., 2006
head morphogenesis disrupted, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 2 , Fig. 6 from Seiliez et al., 2006
head truncated, abnormal	WT + MO1-foxa3 + MO1-gsc	standard conditions	Fig. 6 from Seiliez et al., 2006
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
head truncated, abnormal	WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a	standard conditions	Fig. 6 from Seiliez et al., 2006
eye fused with eye, abnormal	WT + MO1-foxa3 + MO1-gsc + MO1-wnt8a	standard conditions	Fig. 6 from Seiliez et al., 2006

Citations