Morpholino

MO1-mcm5

ID
ZDB-MRPHLNO-060118-1
Name
MO1-mcm5
Previous Names
  • MCM5MO (1)
Target
Sequence
5' - ATAGTTTCGATAAGTGCTGTCGATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mcm5
Expressed Gene Anatomy Figures
etv4 Fig. 4 from Wu et al., 2021
fgf8b Fig. 4 from Wu et al., 2021
fgfr1a Fig. 4 from Wu et al., 2021
rela Fig. 4 from Liu et al., 2009
snai1a Fig. 5 from Liu et al., 2009
sox32 Fig. 6 from Liu et al., 2009
Phenotype
Phenotype resulting from MO1-mcm5
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO1-mcm5 Fig. 3 from Liu et al., 2009
embryo development disrupted, abnormal AB + MO1-mcm5 Fig. 5 from Bicknell et al., 2011
eye decreased size, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
fourth ventricle decreased size, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
gastrulation with mouth forming second disrupted, abnormal AB + MO1-mcm5 Fig. 1 from Liu et al., 2009
head decreased size, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
hindbrain fgfr1a expression decreased distribution, abnormal AB + MO1-mcm5 Fig. 4 from Wu et al., 2021
hindbrain Ab60-h3 labeling decreased distribution, abnormal AB + MO1-mcm5 Fig. 2 from Wu et al., 2021
hindbrain etv4 expression decreased distribution, abnormal AB + MO1-mcm5 Fig. 4 from Wu et al., 2021
hindbrain fgf8b expression increased distribution, abnormal AB + MO1-mcm5 Fig. 4 from Wu et al., 2021
hindbrain apoptotic process increased process quality, abnormal AB + MO1-mcm5 Fig. 3 from Wu et al., 2021
hindbrain cell population proliferation decreased process quality, abnormal AB + MO1-mcm5 Fig. 2 from Wu et al., 2021
hindbrain cranial motor neuron decreased amount, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
hypoblast apoptotic, abnormal AB + MO1-mcm5 Fig. 3 from Liu et al., 2009
midbrain hindbrain boundary blurry, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
regulation of mitotic cell cycle, embryonic disrupted, abnormal AB + MO1-mcm5 Fig. 1 from Liu et al., 2009
rhombomere 5 cranial motor neuron increased amount, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
rhombomere 6 cranial motor neuron increased amount, abnormal AB + MO1-mcm5 Fig. 1 from Wu et al., 2021
rhombomere 7 cranial motor neuron decreased amount, abnormal AB + MO1-mcm5 Fig. 1,  Fig. 4 from Wu et al., 2021
whole organism dwarf-like, abnormal AB + MO1-mcm5 Fig. 5 from Bicknell et al., 2011
whole organism anatomical surface decreased area, abnormal AB + MO1-mcm5 Fig. 5 from Bicknell et al., 2011
Phenotype of all Fish created by or utilizing MO1-mcm5
Phenotype Fish Conditions Figures
hindbrain etv4 expression decreased distribution, abnormal AB + MO1-mcm5 control Fig. 4 from Wu et al., 2021
hypoblast apoptotic, abnormal AB + MO1-mcm5 standard conditions Fig. 3 from Liu et al., 2009
rhombomere 6 cranial motor neuron increased amount, abnormal AB + MO1-mcm5 standard conditions Fig. 1 from Wu et al., 2021
eye decreased size, abnormal AB + MO1-mcm5 control Fig. 1 from Wu et al., 2021
fourth ventricle decreased size, abnormal AB + MO1-mcm5 control Fig. 1 from Wu et al., 2021
whole organism dwarf-like, abnormal AB + MO1-mcm5 standard conditions Fig. 5 from Bicknell et al., 2011
midbrain hindbrain boundary blurry, abnormal AB + MO1-mcm5 control Fig. 1 from Wu et al., 2021
hindbrain fgf8b expression increased distribution, abnormal AB + MO1-mcm5 control Fig. 4 from Wu et al., 2021
hindbrain cranial motor neuron decreased amount, abnormal AB + MO1-mcm5 standard conditions Fig. 1 from Wu et al., 2021
hindbrain apoptotic process increased process quality, abnormal AB + MO1-mcm5 control Fig. 3 from Wu et al., 2021
rhombomere 5 cranial motor neuron increased amount, abnormal AB + MO1-mcm5 standard conditions Fig. 1 from Wu et al., 2021
gastrulation with mouth forming second disrupted, abnormal AB + MO1-mcm5 standard conditions Fig. 1 from Liu et al., 2009
head decreased size, abnormal AB + MO1-mcm5 control Fig. 1 from Wu et al., 2021
rhombomere 7 cranial motor neuron decreased amount, abnormal AB + MO1-mcm5 standard conditions Fig. 1,  Fig. 4 from Wu et al., 2021
apoptotic process increased occurrence, abnormal AB + MO1-mcm5 standard conditions Fig. 3 from Liu et al., 2009
hindbrain fgfr1a expression decreased distribution, abnormal AB + MO1-mcm5 control Fig. 4 from Wu et al., 2021
regulation of mitotic cell cycle, embryonic disrupted, abnormal AB + MO1-mcm5 standard conditions Fig. 1 from Liu et al., 2009
whole organism anatomical surface decreased area, abnormal AB + MO1-mcm5 standard conditions Fig. 5 from Bicknell et al., 2011
hindbrain cell population proliferation decreased process quality, abnormal AB + MO1-mcm5 control Fig. 2 from Wu et al., 2021
embryo development disrupted, abnormal AB + MO1-mcm5 standard conditions Fig. 5 from Bicknell et al., 2011
hindbrain Ab60-h3 labeling decreased distribution, abnormal AB + MO1-mcm5 control Fig. 2 from Wu et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.