Morpholino
MO1-pitpnaa
- ID
- ZDB-MRPHLNO-060111-6
- Name
- MO1-pitpnaa
- Previous Names
-
- MO1-pitpna
- Target
- Sequence
-
5' - CATGTTATCTCCTTTGCCGCCCCGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pitpnaa
Expressed Gene | Anatomy | Figures |
---|---|---|
pitpnaa |
Fig. 2 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-pitpnaa
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-pitpnaa
1 - 5 of 12 Show all
Citations
- Vieira, N.M., Spinazzola, J.M., Alexander, M.S., Moreira, Y.B., Kawahara, G., Gibbs, D.E., Mead, L.C., Verjovski-Almeida, S., Zatz, M., Kunkel, L.M. (2017) Repression of phosphatidylinositol transfer protein α ameliorates the pathology of Duchenne muscular dystrophy. Proceedings of the National Academy of Sciences of the United States of America. 114(23):6080-6085
- Ile, K.E., Kassen, S., Cao, C., Vihtehlic, T., Shah, S.D., Mousley, C.J., Alb, J.G. Jr, Huijbregts, R.P., Stearns, G.W., Brockerhoff, S.E., Hyde, D.R., and Bankaitis, V.A. (2010) Zebrafish Class 1 Phosphatidylinositol Transfer Proteins: PITPbeta and Double Cone Cell Outer Segment Integrity in Retina. Traffic (Copenhagen, Denmark). 11(9):1151-1167
- Xie, Y., Ding, Y.Q., Hong, Y., Feng, Z., Navarre, S., Xi, C.X., Zhu, X.J., Wang, C.L., Ackerman, S.L., Kozlowski, D., Mei, L., and Xiong, W.C. (2005) Phosphatidylinositol transfer protein-alpha in netrin-1-induced PLC signalling and neurite outgrowth. Nature cell biology. 7(11):1124-1132
1 - 3 of 3
Show