Morpholino

MO4-ift88

ID
ZDB-MRPHLNO-050513-2
Name
MO4-ift88
Previous Names
  • MO4-ttc10 (1)
Target
Sequence
5' - CAACTCCACTCACCCCATAAGCTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocking morpholino to ift88 / ttc10 gene
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ift88
Expressed Gene Anatomy Figures
dand5 Fig. 4 with image from Schneider et al., 2010
Phenotype
Phenotype resulting from MO4-ift88
Phenotype Fish Figures
gastrulation disrupted, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
left/right pattern formation disrupted, abnormal WT + MO4-ift88 Fig. 4 with image from Schneider et al., 2010
notochord increased width, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
notochord kinked, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
phototaxis decreased occurrence, abnormal AB/EKW + MO4-ift88 Fig. 5 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal AB/EKW + MO4-ift88 Fig. 5 from Tsai et al., 2019
somite increased width, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
whole organism anterior side disorganized, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
whole organism anterior-posterior axis shortened, abnormal WT + MO4-ift88 Fig. 1 from McIntyre et al., 2012
Phenotype of all Fish created by or utilizing MO4-ift88
Phenotype Fish Conditions Figures
phototaxis decreased occurrence, abnormal AB/EKW + MO4-ift88 standard conditions Fig. 5 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal AB/EKW + MO4-ift88 standard conditions Fig. 5 from Tsai et al., 2019
gastrulation disrupted, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
whole organism anterior side disorganized, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
notochord increased width, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
somite increased width, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
left/right pattern formation disrupted, abnormal WT + MO4-ift88 standard conditions Fig. 4 with image from Schneider et al., 2010
notochord kinked, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
whole organism anterior-posterior axis shortened, abnormal WT + MO4-ift88 standard conditions Fig. 1 from McIntyre et al., 2012
phototaxis occurrence, ameliorated AB/EKW + MO1-usp38 + MO4-ift88 standard conditions Fig. 5 from Tsai et al., 2019
retinal outer nuclear layer ab5-rho labeling position, ameliorated AB/EKW + MO1-usp38 + MO4-ift88 standard conditions Fig. 5 from Tsai et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.