Morpholino

MO1-cxcr4b

ID

ZDB-MRPHLNO-050318-7

Name

MO1-cxcr4b

Previous Names

R4b-2-MO (1)

Target

cxcr4b (1)

Sequence

5' - AAATGATGCTATCGTAAAATTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking morpholino

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cxcr4b

No data available

Phenotype

Phenotype resulting from MO1-cxcr4b

Phenotype	Fish	Figures
olfactory receptor cell mislocalised medially, abnormal	WT + MO1-cxcr4b	Fig. 3 from Miyasaka et al., 2007
olfactory receptor cell mislocalised ventrally, abnormal	WT + MO1-cxcr4b	Fig. 3 from Miyasaka et al., 2007
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-cxcr4b	text only from Dambly-Chaudière et al., 2007
primordial germ cell establishment of cell polarity decreased occurrence, abnormal	mu6Tg + MO1-cxcr4b	Fig. 2 from Tarbashevich et al., 2015
primordial germ cell regulation of intracellular pH process quality, abnormal	mu6Tg + MO1-cxcr4b	Fig. 2 from Tarbashevich et al., 2015

Phenotype of all Fish created by or utilizing MO1-cxcr4b

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-cxcr4b	standard conditions	text only from Dambly-Chaudière et al., 2007
olfactory receptor cell mislocalised medially, abnormal	WT + MO1-cxcr4b	standard conditions	Fig. 3 from Miyasaka et al., 2007
olfactory receptor cell mislocalised ventrally, abnormal	WT + MO1-cxcr4b	standard conditions	Fig. 3 from Miyasaka et al., 2007
primordial germ cell mislocalised, abnormal	WT + MO1-cxcr4b + MO3-cxcr4b	standard conditions	Fig. 2 from Boldajipour et al., 2008
germ cell migration process quality, abnormal	WT + MO1-cxcr4b + MO3-cxcr4b	standard conditions	Fig. 2 from Boldajipour et al., 2008
primordial germ cell establishment of cell polarity decreased occurrence, abnormal	mu2Tg + MO1-cxcr4b	standard conditions	Fig. 2 from Tarbashevich et al., 2015
primordial germ cell regulation of intracellular pH process quality, abnormal	mu2Tg + MO1-cxcr4b	standard conditions	Fig. 2 from Tarbashevich et al., 2015
primordial germ cell establishment of cell polarity decreased occurrence, abnormal	mu6Tg + MO1-cxcr4b	standard conditions	Fig. 2 from Tarbashevich et al., 2015
primordial germ cell regulation of intracellular pH process quality, abnormal	mu6Tg + MO1-cxcr4b	standard conditions	Fig. 2 from Tarbashevich et al., 2015
retinal ganglion cell axon guidance disrupted, abnormal	robo2^te284/te284 + MO1-cxcr4b	standard conditions	Fig. 2 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal	robo2^te284/te284 + MO1-cxcr4b	standard conditions	Fig. 2 from Chalasani et al., 2007
cranial nerve III mislocalised, abnormal	robo2^{ti272z/ti272z} + MO1-cxcr4b	standard conditions	Fig. 2 from Chalasani et al., 2007
retinal ganglion cell axon guidance disrupted, abnormal	robo2^{ti272z/ti272z} + MO1-cxcr4b	standard conditions	Fig. 2 from Chalasani et al., 2007
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-cxcr4b + MO6-ackr3b	standard conditions	text only from Dambly-Chaudière et al., 2007

Citations