Morpholino

MO1-wnt4

ID
ZDB-MRPHLNO-050318-1
Name
MO1-wnt4
Previous Names
  • MO1-wnt4a
  • wnt4-MO (1)
Target
Sequence
5' - CTCCGATGACATCTTTAGTGGAATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the translation initiation site of wnt4a.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt4
Expressed Gene Anatomy Figures
eaf1 Fig. 1 with image from Wan et al., 2010
eaf2 Fig. 1 with image from Wan et al., 2010
Phenotype
Phenotype resulting from MO1-wnt4
Phenotype Fish Figures
convergent extension disrupted, abnormal AB + MO1-wnt4 Fig. Table 2 from Matsui et al., 2005
habenular commissure aplastic, abnormal WT + MO1-wnt4 Fig. 7 with image from Hendricks et al., 2008
Phenotype of all Fish created by or utilizing MO1-wnt4
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO1-wnt4 standard conditions Fig. Table 2 from Matsui et al., 2005
habenular commissure aplastic, abnormal WT + MO1-wnt4 standard conditions Fig. 7 with image from Hendricks et al., 2008
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
eye fused with eye, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
neural tube formation disrupted, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
post-vent region bent, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
whole organism decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
brain morphology, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
extension decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
extension increased width, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
post-vent region decreased length, abnormal wnt11f2tx226/tx226; wnt5bsk13/sk13 + MO1-wnt4 standard conditions Fig. S4 from Ciruna et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.