Morpholino
MO1-chsy1
- ID
- ZDB-MRPHLNO-050218-1
- Name
- MO1-chsy1
- Previous Names
-
- cs1
- MO1-chys1 (1)
- Target
- Sequence
-
5' - AAGATCTGCGACTCCTTCCTGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Morpholino designed against the translational start site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chsy1
Expressed Gene | Anatomy | Figures |
---|---|---|
msx3 |
Fig. 5
from Li et al., 2010 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-chsy1
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO1-chsy1
1 - 5 of 42 Show all
Citations
- Holmborn, K., Habicher, J., Kasza, Z., Eriksson, A.S., Filipek-Gorniok, B., Gopal, S., Couchman, J.R., Ahlberg, P., Wiweger, M., Spillman, D., Kreuger, J., and Ledin, J. (2012) On the roles and regulation of chondroitin sulfate and heparan sulfate in zebrafish pharyngeal cartilage morphogenesis. The Journal of biological chemistry. 287(40):33905-33916
- Li, Y., Laue, K., Temtamy, S., Aglan, M., Kotan, L.D., Yigit, G., Canan, H., Pawlik, B., Nürnberg, G., Wakeling, E.L., Quarrell, O.W., Baessmann, I., Lanktree, M.B., Yilmaz, M., Hegele, R.A., Amr, K., May, K.W., Nürnberg, P., Topaloglu, A.K., Hammerschmidt, M., and Wollnik, B. (2010) Temtamy Preaxial Brachydactyly Syndrome Is Caused by Loss-of-Function Mutations in Chondroitin Synthase 1, a Potential Target of BMP Signaling. American journal of human genetics. 87(6):757-767
- Tian, J., Ling, L., Shboul, M., Lee, H., O'Connor, B., Merriman, B., Nelson, S.F., Cool, S., Ababneh, O.H., Al-Hadidy, A., Masri, A., Hamamy, H., and Reversade, B. (2010) Loss of CHSY1, a Secreted FRINGE Enzyme, Causes Syndromic Brachydactyly in Humans via Increased NOTCH Signaling. American journal of human genetics. 87(6):768-778
- Peal, D.S., Burns, C.G., MacRae, C.A., and Milan, D. (2009) Chondroitin sulfate expression is required for cardiac atrioventricular canal formation. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(12):3103-3110
- Zhang, J., Lefebvre, J.L., Zhao, S., and Granato, M. (2004) Zebrafish unplugged reveals a role for muscle-specific kinase homologs in axonal pathway choice. Nature Neuroscience. 7(12):1303-1309
1 - 5 of 5
Show