Morpholino

MO1-notch2

ID
ZDB-MRPHLNO-041207-6
Name
MO1-notch2
Previous Names
  • MO-notch2-1 (1)
Target
Sequence
5' - AGGTGAACACTTACTTCATGCCAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed to bind to exon-intron region, predicted to generate a premature stop codon after the last exon 7 codon, thus deleting the entire ankyrin repeat domain.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch2
Expressed Gene Anatomy Figures
dlx2a Fig. 2 with image,  Fig. 4 with image from Zuniga et al., 2010
dlx3b Fig. 2 with image from Zuniga et al., 2010
dlx5a Fig. 2 with image from Zuniga et al., 2010
ephb2a Fig. S4 from Geudens et al., 2010
flt4 Fig. S4 from Geudens et al., 2010
hey1 Fig. 4 with image from Zuniga et al., 2010
jag1b Fig. 4 with image from Zuniga et al., 2010
notch2 Fig. 4 with image from Zuniga et al., 2010
Phenotype
Phenotype resulting from MO1-notch2
Phenotype Fish Figures
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-notch2 Fig. S10 from O'Hare et al., 2016
endocrine pancreas decreased size, abnormal nl1Tg + MO1-notch2 Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-notch2 Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-notch2 Fig. S10 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 Fig. S15 from O'Hare et al., 2016
hyosymplectic cartilage deformed, abnormal WT + MO1-notch2 Fig. 1 with image from Zuniga et al., 2010
hyosymplectic cartilage elongated, abnormal WT + MO1-notch2 Fig. 1 with image from Zuniga et al., 2010
lymphangiogenesis disrupted, abnormal WT + MO1-notch2 Fig. 1 from Geudens et al., 2010
opercle curved, abnormal WT + MO1-notch2 Fig. 1 with image from Zuniga et al., 2010
opercle decreased width, abnormal WT + MO1-notch2 Fig. 1 with image from Zuniga et al., 2010
palatoquadrate cartilage truncated, abnormal WT + MO1-notch2 Fig. 1 with image from Zuniga et al., 2010
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal jh1Tg; jh2Tg + MO1-notch2 Fig. 1 from O'Hare et al., 2016
thoracic duct absent, abnormal WT + MO1-notch2 Fig. 1 from Geudens et al., 2010
thoracic duct wholeness, abnormal WT + MO1-notch2 Fig. 1 from Geudens et al., 2010
Phenotype of all Fish created by or utilizing MO1-notch2
Phenotype Fish Conditions Figures
thoracic duct absent, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
opercle curved, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
opercle decreased width, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
thoracic duct wholeness, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
palatoquadrate cartilage truncated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
hyosymplectic cartilage elongated, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
lymphangiogenesis disrupted, abnormal WT + MO1-notch2 standard conditions Fig. 1 from Geudens et al., 2010
hyosymplectic cartilage deformed, abnormal WT + MO1-notch2 standard conditions Fig. 1 with image from Zuniga et al., 2010
endocrine pancreas decreased size, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
enteroendocrine cell differentiation disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas EGFP expression decreased distribution, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
endocrine pancreas development disrupted, abnormal nl1Tg + MO1-notch2 standard conditions Fig. S10 from O'Hare et al., 2016
response to glucose decreased process quality, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 2 from O'Hare et al., 2016
pancreatic B cell decreased amount, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. 4 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 chemical treatment by environment: glucose Fig. S15 from O'Hare et al., 2016
glucose homeostasis disrupted, abnormal jh1Tg; jh2Tg + MO1-notch2 control Fig. S15 from O'Hare et al., 2016
pancreatic B cell decreased area, abnormal jh1Tg; jh2Tg + MO1-notch2 standard conditions Fig. 1 from O'Hare et al., 2016
symplectic decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
ceratohyal cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage morphology, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
Meckel's cartilage decreased size, abnormal edn1tf216b/tf216b + MO1-notch2 standard conditions Fig. 6 with image from Zuniga et al., 2010
pancreatic B cell regeneration decreased rate, abnormal jh4Tg + MO1-notch2 chemical ablation: pancreatic B cell, chemical treatment by environment: metronidazole Fig. 5 from O'Hare et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.